EMAIL THIS PAGE TO A FRIEND

ARAP2

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2

167 Gene Product Result for
Synonyms: CENTD1 PARX
UniProtKB ID: Q8WZ64, Q4W5D2, Q7Z2L5, Q96L70, Q96P49, Q9Y4E4
Gene ID:
Human(116984) Summary: The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]
Mouse(212285) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Rat(305367) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
chicken(428790) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
dog(488840) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Horse(100065339) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
cow(512010) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
domestic cat(101096980) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
domestic guinea pig(100719036) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
naked mole-rat(101709490) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
sheep(101109800) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015230 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015230 Rosetta Predictions human pricing
NM_139182 Rosetta Predictions human pricing
NM_001107216 Rosetta Predictions rat pricing
NM_178407 Rosetta Predictions mouse pricing
XM_132099 Rosetta Predictions mouse pricing
XM_900346 Rosetta Predictions mouse pricing
XM_900356 Rosetta Predictions mouse pricing
XM_900367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347344 predicted 3840
2 SASI_Hs01_00172265 predicted 3723
3 SASI_Hs01_00172267 predicted 3790
4 SASI_Hs02_00347345 predicted 2981
5 SASI_Hs02_00347346 predicted 4145
6 SASI_Hs01_00172269 predicted 4120
7 SASI_Hs02_00347347 predicted 5363
8 SASI_Hs01_00172270 predicted 3871
9 SASI_Hs02_00347348 predicted 4851
10 SASI_Hs02_00347349 predicted 4342
11 SASI_Hs01_00172263 predicted 4594
12 SASI_Hs01_00172264 predicted 4197
13 SASI_Hs01_00172266 predicted 4671
14 SASI_Hs01_00172268 predicted 3677
15 SASI_Hs01_00172271 predicted 4154
16 SASI_Hs01_00172272 predicted 3617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364221 predicted 1296
2 SASI_Hs01_00072372 predicted 1179
3 SASI_Hs01_00072374 predicted 1248
4 SASI_Hs02_00364222 predicted 436
5 SASI_Hs02_00364223 predicted 1597
6 SASI_Hs01_00072375 predicted 1569
7 SASI_Hs02_00364224 predicted 2823
8 SASI_Hs01_00072376 predicted 1327
9 SASI_Hs02_00364225 predicted 2303
10 SASI_Hs01_00072379 predicted 1795
11 SASI_Hs01_00072370 predicted 2051
12 SASI_Hs01_00072371 predicted 1655
13 SASI_Hs01_00072373 predicted 2118
14 SASI_Hs01_00072377 predicted 1617
15 SASI_Hs01_00072378 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226655 predicted 569
2 SASI_Rn02_00226656 predicted 3015
3 SASI_Rn02_00226657 predicted 3459
4 SASI_Rn02_00226658 predicted 4884
5 SASI_Rn02_00226659 predicted 2235
6 SASI_Rn02_00226660 predicted 4182
7 SASI_Rn02_00226661 predicted 4826
8 SASI_Rn02_00226662 predicted 3914
9 SASI_Rn02_00226663 predicted 4376
10 SASI_Rn02_00226664 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348839 predicted 3233
2 SASI_Mm02_00348840 predicted 2835
3 SASI_Mm02_00348841 predicted 535
4 SASI_Mm02_00348842 predicted 561
5 SASI_Mm02_00348843 predicted 817
6 SASI_Mm02_00348844 predicted 4439
7 SASI_Mm02_00348845 predicted 501
8 SASI_Mm02_00348846 predicted 5437
9 SASI_Mm02_00348847 predicted 4485
10 SASI_Mm02_00348848 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236616 predicted 3163
2 SASI_Mm01_00236617 predicted 2760
3 SASI_Mm01_00236618 predicted 457
4 SASI_Mm01_00236619 predicted 4356
5 SASI_Mm01_00236620 predicted 421
6 SASI_Mm01_00236621 predicted 5357
7 SASI_Mm01_00236622 predicted 4412
8 SASI_Mm01_00236623 predicted 1032
9 SASI_Mm01_00236624 predicted 4067
10 SASI_Mm01_00236625 predicted 5327
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259438 predicted 4206
2 SASI_Mm01_00259439 predicted 3156
3 SASI_Mm01_00259440 predicted 2753
4 SASI_Mm01_00259441 predicted 455
5 SASI_Mm01_00259442 predicted 475
6 SASI_Mm01_00259443 predicted 726
7 SASI_Mm01_00259444 predicted 409
8 SASI_Mm01_00259445 predicted 1020
9 SASI_Mm01_00259446 predicted 4059
10 SASI_Mm01_00259447 predicted 4070
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279355 predicted 2235
2 SASI_Mm01_00279356 predicted 2302
3 SASI_Mm01_00279357 predicted 2189
4 SASI_Mm01_00279358 predicted 1967
5 SASI_Mm01_00279359 predicted 2248
6 SASI_Mm01_00279360 predicted 1909
7 SASI_Mm01_00279361 predicted 2038
8 SASI_Mm01_00279362 predicted 2435
9 SASI_Mm01_00279363 predicted 2241
10 SASI_Mm01_00279364 predicted 2263
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265774 predicted 3149
2 SASI_Mm01_00265775 predicted 2753
3 SASI_Mm01_00265776 predicted 454
4 SASI_Mm01_00265777 predicted 4349
5 SASI_Mm01_00265778 predicted 409
6 SASI_Mm01_00265779 predicted 5357
7 SASI_Mm01_00265780 predicted 4396
8 SASI_Mm01_00265781 predicted 1029
9 SASI_Mm01_00265782 predicted 4059
10 SASI_Mm01_00265783 predicted 5328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015230
ARAP2 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149818    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015230.2-6053s1c1
Sequence:CCGGCCAGAACTTGTCAATGAGAAACTCGAGTTTCTCATTGACAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015230.2-4062s1c1
Sequence:CCGGGCTATCATTGAACACCTGTATCTCGAGATACAGGTGTTCAATGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015230.2-5840s1c1
Sequence:CCGGGCACTTTGAGAAACCTTGTATCTCGAGATACAAGGTTTCTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015230.2-5659s1c1
Sequence:CCGGCCTTGTAAAGTTCCATTGTATCTCGAGATACAATGGAACTTTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015230.2-1633s1c1
Sequence:CCGGCATCTAAATCTAGGACTCAAACTCGAGTTTGAGTCCTAGATTTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015230.2-4349s21c1
Sequence:CCGGGGAACCCGACTGTAGTATTATCTCGAGATAATACTACAGTCGGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015230.2-1774s21c1
Sequence:CCGGCATCTGCAAAGAAGGTTAAATCTCGAGATTTAACCTTCTTTGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015230.2-503s21c1
Sequence:CCGGTCACCGTAGGAGGATACTTAACTCGAGTTAAGTATCCTCCTACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015230
ARAP2 MISSION shRNA shRNA Plasmid DNA
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149818    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015230.2-6053s1c1
Sequence:CCGGCCAGAACTTGTCAATGAGAAACTCGAGTTTCTCATTGACAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015230.2-4062s1c1
Sequence:CCGGGCTATCATTGAACACCTGTATCTCGAGATACAGGTGTTCAATGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015230.2-5840s1c1
Sequence:CCGGGCACTTTGAGAAACCTTGTATCTCGAGATACAAGGTTTCTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015230.2-5659s1c1
Sequence:CCGGCCTTGTAAAGTTCCATTGTATCTCGAGATACAATGGAACTTTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015230.2-1633s1c1
Sequence:CCGGCATCTAAATCTAGGACTCAAACTCGAGTTTGAGTCCTAGATTTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015230.2-4349s21c1
Sequence:CCGGGGAACCCGACTGTAGTATTATCTCGAGATAATACTACAGTCGGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015230.2-1774s21c1
Sequence:CCGGCATCTGCAAAGAAGGTTAAATCTCGAGATTTAACCTTCTTTGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015230.2-503s21c1
Sequence:CCGGTCACCGTAGGAGGATACTTAACTCGAGTTAAGTATCCTCCTACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015230
ARAP2 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149818    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015230.2-6053s1c1
Sequence:CCGGCCAGAACTTGTCAATGAGAAACTCGAGTTTCTCATTGACAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015230.2-4062s1c1
Sequence:CCGGGCTATCATTGAACACCTGTATCTCGAGATACAGGTGTTCAATGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015230.2-5840s1c1
Sequence:CCGGGCACTTTGAGAAACCTTGTATCTCGAGATACAAGGTTTCTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015230.2-5659s1c1
Sequence:CCGGCCTTGTAAAGTTCCATTGTATCTCGAGATACAATGGAACTTTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015230.2-1633s1c1
Sequence:CCGGCATCTAAATCTAGGACTCAAACTCGAGTTTGAGTCCTAGATTTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015230.2-4349s21c1
Sequence:CCGGGGAACCCGACTGTAGTATTATCTCGAGATAATACTACAGTCGGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015230.2-1774s21c1
Sequence:CCGGCATCTGCAAAGAAGGTTAAATCTCGAGATTTAACCTTCTTTGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015230.2-503s21c1
Sequence:CCGGTCACCGTAGGAGGATACTTAACTCGAGTTAAGTATCCTCCTACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178407
VALIDATED
ARAP2 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178407.3-2291s21c1
Sequence:CCGGGACTCGGTATTACCATAATTCCTCGAGGAATTATGGTAATACCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178407.3-2200s21c1
Sequence:CCGGCTTGAATTGAGAGGGTATAAACTCGAGTTTATACCCTCTCAATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178407.3-5810s21c1
Sequence:CCGGAGATGTGTAAGTGGGTTAATTCTCGAGAATTAACCCACTTACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178407.3-2666s21c1
Sequence:CCGGATGAGCTCATTGAGCTATTTACTCGAGTAAATAGCTCAATGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178407.3-4431s21c1
Sequence:CCGGGGAGCCAGACTGTAGTATTATCTCGAGATAATACTACAGTCTGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178407
VALIDATED
ARAP2 MISSION shRNA shRNA Plasmid DNA
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178407.3-2291s21c1
Sequence:CCGGGACTCGGTATTACCATAATTCCTCGAGGAATTATGGTAATACCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178407.3-2200s21c1
Sequence:CCGGCTTGAATTGAGAGGGTATAAACTCGAGTTTATACCCTCTCAATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178407.3-5810s21c1
Sequence:CCGGAGATGTGTAAGTGGGTTAATTCTCGAGAATTAACCCACTTACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178407.3-2666s21c1
Sequence:CCGGATGAGCTCATTGAGCTATTTACTCGAGTAAATAGCTCAATGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178407.3-4431s21c1
Sequence:CCGGGGAGCCAGACTGTAGTATTATCTCGAGATAATACTACAGTCTGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178407
VALIDATED
ARAP2 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178407.3-2291s21c1
Sequence:CCGGGACTCGGTATTACCATAATTCCTCGAGGAATTATGGTAATACCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178407.3-2200s21c1
Sequence:CCGGCTTGAATTGAGAGGGTATAAACTCGAGTTTATACCCTCTCAATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178407.3-5810s21c1
Sequence:CCGGAGATGTGTAAGTGGGTTAATTCTCGAGAATTAACCCACTTACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178407.3-2666s21c1
Sequence:CCGGATGAGCTCATTGAGCTATTTACTCGAGTAAATAGCTCAATGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178407.3-4431s21c1
Sequence:CCGGGGAGCCAGACTGTAGTATTATCTCGAGATAATACTACAGTCTGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks