EMAIL THIS PAGE TO A FRIEND

ARAP3

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3

116 Gene Product Result for
Synonyms: CENTD3 DRAG1
UniProtKB ID: Q8WWN8, D3DQE3
Gene ID:
Human(64411) Summary: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. An alternatively spliced transcript has been found for this gene, but its biological validity has not been determined. [provided by RefSeq, Sep 2008]
Mouse(106952) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Rat(361314) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
sheep(101105821) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Domestic Rabbit(100354264) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
naked mole-rat(101709044) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
domestic guinea pig(100721743) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Zebrafish(558931) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
cow(100337193) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
cow(513722) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
domestic cat(101080259) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
dog(487188) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
chicken(416196) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0058 AQUA Peptide (pS)LDQPFLS[K] human pricing
AQ0059 AQUA Peptide SLDQPFLS[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022481 Rosetta Predictions human pricing
XM_001066167 Rosetta Predictions rat pricing
XM_341602 Rosetta Predictions rat pricing
NM_139206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022034 predicted 1848
2 SASI_Hs01_00022038 predicted 1603
3 SASI_Hs02_00355761 predicted 2110
4 SASI_Hs01_00022039 predicted 2983
5 SASI_Hs01_00022040 predicted 2221
6 SASI_Hs02_00355762 predicted 3317
7 SASI_Hs01_00022042 predicted 1536
8 SASI_Hs01_00022043 predicted 3434
9 SASI_Hs02_00355763 predicted 4212
10 SASI_Hs02_00355764 predicted 1862
11 SASI_Hs01_00022035 predicted 1556
12 SASI_Hs01_00022036 predicted 1737
13 SASI_Hs01_00022037 predicted 3330
14 SASI_Hs01_00022041 predicted 4124
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316488 predicted 3643
2 SASI_Rn02_00316489 predicted 1938
3 SASI_Rn02_00316490 predicted 3582
4 SASI_Rn02_00316491 predicted 4249
5 SASI_Rn02_00316492 predicted 2907
6 SASI_Rn02_00316493 predicted 3043
7 SASI_Rn02_00316494 predicted 3683
8 SASI_Rn02_00316495 predicted 1196
9 SASI_Rn02_00316496 predicted 2074
10 SASI_Rn02_00316497 predicted 2484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139603 predicted 1651
2 SASI_Rn01_00139604 predicted 478
3 SASI_Rn01_00139605 predicted 3383
4 SASI_Rn01_00139606 predicted 3647
5 SASI_Rn01_00139607 predicted 2752
6 SASI_Rn01_00139608 predicted 896
7 SASI_Rn01_00139609 predicted 1779
8 SASI_Rn01_00139610 predicted 2199
9 SASI_Rn01_00139611 predicted 3135
10 SASI_Rn01_00139612 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339921 predicted 523
2 SASI_Mm01_00053770 predicted 1510
3 SASI_Mm01_00053771 predicted 3401
4 SASI_Mm01_00053773 predicted 941
5 SASI_Mm01_00053774 predicted 1702
6 SASI_Mm01_00053775 predicted 1503
7 SASI_Mm01_00053776 predicted 1691
8 SASI_Mm02_00339922 predicted 3333
9 SASI_Mm01_00053778 predicted 4182
10 SASI_Mm01_00053779 predicted 2733
11 SASI_Mm01_00053772 predicted 3291
12 SASI_Mm01_00053777 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022481
VALIDATED
ARAP3 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-3430s21c1
Sequence:CCGGGACCTCATCATGGAAGTTTATCTCGAGATAAACTTCCATGATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022481.5-5110s21c1
Sequence:CCGGAGAGGCCTGGGTGATGTTAAACTCGAGTTTAACATCACCCAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-3918s21c1
Sequence:CCGGGGGAATCCGCAAGAAGTTAAACTCGAGTTTAACTTCTTGCGGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-4024s21c1
Sequence:CCGGTGGACCACCAGCATCCTTAAACTCGAGTTTAAGGATGCTGGTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-1899s21c1
Sequence:CCGGCCCTCAGTACCCAGATCATAGCTCGAGCTATGATCTGGGTACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-3201s21c1
Sequence:CCGGGCAGAAATGTGCGGCTCTAAACTCGAGTTTAGAGCCGCACATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022481.4-2951s1c1
Sequence:CCGGCCCAGATAAGAAAGAGCATTTCTCGAGAAATGCTCTTTCTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_022481.4-2004s1c1
Sequence:CCGGGTCTGGAGTAATGAGATAGTACTCGAGTACTATCTCATTACTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022481.4-797s1c1
Sequence:CCGGAGCCCTAAATACTGTGGAGATCTCGAGATCTCCACAGTATTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022481.4-3662s1c1
Sequence:CCGGCAGTCTTATCACCACCTGGAACTCGAGTTCCAGGTGGTGATAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_022481.4-1347s1c1
Sequence:CCGGGTGATACCTTTGACTGCCATTCTCGAGAATGGCAGTCAAAGGTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022481
VALIDATED
ARAP3 MISSION shRNA shRNA Plasmid DNA
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-3430s21c1
Sequence:CCGGGACCTCATCATGGAAGTTTATCTCGAGATAAACTTCCATGATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022481.5-5110s21c1
Sequence:CCGGAGAGGCCTGGGTGATGTTAAACTCGAGTTTAACATCACCCAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-3918s21c1
Sequence:CCGGGGGAATCCGCAAGAAGTTAAACTCGAGTTTAACTTCTTGCGGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-4024s21c1
Sequence:CCGGTGGACCACCAGCATCCTTAAACTCGAGTTTAAGGATGCTGGTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-1899s21c1
Sequence:CCGGCCCTCAGTACCCAGATCATAGCTCGAGCTATGATCTGGGTACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-3201s21c1
Sequence:CCGGGCAGAAATGTGCGGCTCTAAACTCGAGTTTAGAGCCGCACATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022481.4-2951s1c1
Sequence:CCGGCCCAGATAAGAAAGAGCATTTCTCGAGAAATGCTCTTTCTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_022481.4-2004s1c1
Sequence:CCGGGTCTGGAGTAATGAGATAGTACTCGAGTACTATCTCATTACTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022481.4-797s1c1
Sequence:CCGGAGCCCTAAATACTGTGGAGATCTCGAGATCTCCACAGTATTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022481.4-3662s1c1
Sequence:CCGGCAGTCTTATCACCACCTGGAACTCGAGTTCCAGGTGGTGATAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_022481.4-1347s1c1
Sequence:CCGGGTGATACCTTTGACTGCCATTCTCGAGAATGGCAGTCAAAGGTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022481
VALIDATED
ARAP3 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-3430s21c1
Sequence:CCGGGACCTCATCATGGAAGTTTATCTCGAGATAAACTTCCATGATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022481.5-5110s21c1
Sequence:CCGGAGAGGCCTGGGTGATGTTAAACTCGAGTTTAACATCACCCAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-3918s21c1
Sequence:CCGGGGGAATCCGCAAGAAGTTAAACTCGAGTTTAACTTCTTGCGGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-4024s21c1
Sequence:CCGGTGGACCACCAGCATCCTTAAACTCGAGTTTAAGGATGCTGGTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-1899s21c1
Sequence:CCGGCCCTCAGTACCCAGATCATAGCTCGAGCTATGATCTGGGTACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022481.5-3201s21c1
Sequence:CCGGGCAGAAATGTGCGGCTCTAAACTCGAGTTTAGAGCCGCACATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022481.4-2951s1c1
Sequence:CCGGCCCAGATAAGAAAGAGCATTTCTCGAGAAATGCTCTTTCTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_022481.4-2004s1c1
Sequence:CCGGGTCTGGAGTAATGAGATAGTACTCGAGTACTATCTCATTACTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022481.4-797s1c1
Sequence:CCGGAGCCCTAAATACTGTGGAGATCTCGAGATCTCCACAGTATTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022481.4-3662s1c1
Sequence:CCGGCAGTCTTATCACCACCTGGAACTCGAGTTCCAGGTGGTGATAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_022481.4-1347s1c1
Sequence:CCGGGTGATACCTTTGACTGCCATTCTCGAGAATGGCAGTCAAAGGTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139206
VALIDATED
ARAP3 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139206.2-3170s21c1
Sequence:CCGGGCAGAAGTGTGCGTCTCTAAACTCGAGTTTAGAGACGCACACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139206.2-2949s21c1
Sequence:CCGGCCACGGGAACACTTTGTAGAACTCGAGTTCTACAAAGTGTTCCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139206.2-4883s21c1
Sequence:CCGGCTGTACTATGAAGTCACTAAACTCGAGTTTAGTGACTTCATAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139206.2-4252s21c1
Sequence:CCGGTGTATGAAGAGCCAGTATATGCTCGAGCATATACTGGCTCTTCATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139206.2-2850s21c1
Sequence:CCGGCTCCGGCTGGAAGGTGTATATCTCGAGATATACACCTTCCAGCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139206.1-4833s1c1
Sequence:CCGGCTGTACTATGAAGTCACTAAACTCGAGTTTAGTGACTTCATAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139206.1-2899s1c1
Sequence:CCGGCCACGGGAACACTTTGTAGAACTCGAGTTCTACAAAGTGTTCCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139206.1-1665s1c1
Sequence:CCGGGCTGTTCATTGTCCTGGGAAACTCGAGTTTCCCAGGACAATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139206.1-219s1c1
Sequence:CCGGCCTGGATTCTCATCTGGATAACTCGAGTTATCCAGATGAGAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139206
VALIDATED
ARAP3 MISSION shRNA shRNA Plasmid DNA
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139206.2-3170s21c1
Sequence:CCGGGCAGAAGTGTGCGTCTCTAAACTCGAGTTTAGAGACGCACACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139206.2-2949s21c1
Sequence:CCGGCCACGGGAACACTTTGTAGAACTCGAGTTCTACAAAGTGTTCCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139206.2-4883s21c1
Sequence:CCGGCTGTACTATGAAGTCACTAAACTCGAGTTTAGTGACTTCATAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139206.2-4252s21c1
Sequence:CCGGTGTATGAAGAGCCAGTATATGCTCGAGCATATACTGGCTCTTCATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139206.2-2850s21c1
Sequence:CCGGCTCCGGCTGGAAGGTGTATATCTCGAGATATACACCTTCCAGCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139206.1-4833s1c1
Sequence:CCGGCTGTACTATGAAGTCACTAAACTCGAGTTTAGTGACTTCATAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139206.1-2899s1c1
Sequence:CCGGCCACGGGAACACTTTGTAGAACTCGAGTTCTACAAAGTGTTCCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139206.1-1665s1c1
Sequence:CCGGGCTGTTCATTGTCCTGGGAAACTCGAGTTTCCCAGGACAATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139206.1-219s1c1
Sequence:CCGGCCTGGATTCTCATCTGGATAACTCGAGTTATCCAGATGAGAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139206
VALIDATED
ARAP3 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139206.2-3170s21c1
Sequence:CCGGGCAGAAGTGTGCGTCTCTAAACTCGAGTTTAGAGACGCACACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139206.2-2949s21c1
Sequence:CCGGCCACGGGAACACTTTGTAGAACTCGAGTTCTACAAAGTGTTCCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139206.2-4883s21c1
Sequence:CCGGCTGTACTATGAAGTCACTAAACTCGAGTTTAGTGACTTCATAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139206.2-4252s21c1
Sequence:CCGGTGTATGAAGAGCCAGTATATGCTCGAGCATATACTGGCTCTTCATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139206.2-2850s21c1
Sequence:CCGGCTCCGGCTGGAAGGTGTATATCTCGAGATATACACCTTCCAGCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139206.1-4833s1c1
Sequence:CCGGCTGTACTATGAAGTCACTAAACTCGAGTTTAGTGACTTCATAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139206.1-2899s1c1
Sequence:CCGGCCACGGGAACACTTTGTAGAACTCGAGTTCTACAAAGTGTTCCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139206.1-1665s1c1
Sequence:CCGGGCTGTTCATTGTCCTGGGAAACTCGAGTTTCCCAGGACAATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139206.1-219s1c1
Sequence:CCGGCCTGGATTCTCATCTGGATAACTCGAGTTATCCAGATGAGAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks