EMAIL THIS PAGE TO A FRIEND

ARC

activity-regulated cytoskeleton-associated protein

64 Gene Product Result for
Synonyms: Arg3.1
UniProtKB ID: Q7LC44, Q9UJW6, Q9Y469
Gene ID:
Mouse(11838) activity regulated cytoskeletal-associated protein
Rat(54323) activity-regulated cytoskeleton-associated protein
chicken(395075) activity-regulated cytoskeleton-associated protein
cow(519403) activity-regulated cytoskeleton-associated protein
domestic cat(101097045) activity-regulated cytoskeleton-associated protein
domestic guinea pig(100724032) activity-regulated cytoskeleton-associated protein
naked mole-rat(101705961) activity-regulated cytoskeleton-associated protein
sheep(101120169) activity-regulated cytoskeleton-associated protein
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015193 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015193 Rosetta Predictions human pricing
NM_019361 Rosetta Predictions rat pricing
NM_018790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347261 predicted 1434
2 SASI_Hs01_00125306 predicted 948
3 SASI_Hs01_00125308 predicted 1132
4 SASI_Hs01_00125309 predicted 1769
5 SASI_Hs02_00347262 predicted 519
6 SASI_Hs01_00125310 predicted 980
7 SASI_Hs01_00125311 predicted 1527
8 SASI_Hs01_00125312 predicted 1382
9 SASI_Hs01_00125314 predicted 1093
10 SASI_Hs01_00125315 predicted 588
11 SASI_Hs01_00125307 predicted 1439
12 SASI_Hs01_00125313 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110999 predicted 293
2 SASI_Rn01_00111000 predicted 959
3 SASI_Rn01_00111002 predicted 422
4 SASI_Rn01_00111003 predicted 1122
5 SASI_Rn01_00111004 predicted 353
6 SASI_Rn01_00111005 predicted 370
7 SASI_Rn01_00111006 predicted 1671
8 SASI_Rn01_00111007 predicted 1861
9 SASI_Rn01_00111008 predicted 393
10 SASI_Rn02_00262381 predicted 1684
11 SASI_Rn01_00111001 predicted 1666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138967 predicted 268
2 SASI_Mm01_00138968 predicted 586
3 SASI_Mm01_00138969 predicted 1657
4 SASI_Mm01_00138970 predicted 746
5 SASI_Mm01_00138971 predicted 683
6 SASI_Mm01_00138972 predicted 1522
7 SASI_Mm01_00138973 predicted 1008
8 SASI_Mm01_00138974 predicted 334
9 SASI_Mm01_00138975 predicted 1187
10 SASI_Mm01_00138976 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018790
ARC MISSION shRNA Bacterial Glycerol Stock
activity-regulated cytoskeleton-associated protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018790.1-1997s1c1
Sequence:CCGGGCAGTGATTCATACCAGTGAACTCGAGTTCACTGGTATGAATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018790.1-676s1c1
Sequence:CCGGGATGGCTATGACTATACCGTTCTCGAGAACGGTATAGTCATAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018790.1-1141s1c1
Sequence:CCGGGAGGAGGAGATCATTCAGTATCTCGAGATACTGAATGATCTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018790.1-262s1c1
Sequence:CCGGCCCAATGTGATCCTGCAGATTCTCGAGAATCTGCAGGATCACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018790.1-749s1c1
Sequence:CCGGAGTCAGTTGAGGCTCAGCAATCTCGAGATTGCTGAGCCTCAACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018790
ARC MISSION shRNA shRNA Plasmid DNA
activity-regulated cytoskeleton-associated protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018790.1-1997s1c1
Sequence:CCGGGCAGTGATTCATACCAGTGAACTCGAGTTCACTGGTATGAATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018790.1-676s1c1
Sequence:CCGGGATGGCTATGACTATACCGTTCTCGAGAACGGTATAGTCATAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018790.1-1141s1c1
Sequence:CCGGGAGGAGGAGATCATTCAGTATCTCGAGATACTGAATGATCTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018790.1-262s1c1
Sequence:CCGGCCCAATGTGATCCTGCAGATTCTCGAGAATCTGCAGGATCACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018790.1-749s1c1
Sequence:CCGGAGTCAGTTGAGGCTCAGCAATCTCGAGATTGCTGAGCCTCAACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018790
ARC MISSION shRNA Lentiviral Transduction Particles
activity-regulated cytoskeleton-associated protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018790.1-1997s1c1
Sequence:CCGGGCAGTGATTCATACCAGTGAACTCGAGTTCACTGGTATGAATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018790.1-676s1c1
Sequence:CCGGGATGGCTATGACTATACCGTTCTCGAGAACGGTATAGTCATAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018790.1-1141s1c1
Sequence:CCGGGAGGAGGAGATCATTCAGTATCTCGAGATACTGAATGATCTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018790.1-262s1c1
Sequence:CCGGCCCAATGTGATCCTGCAGATTCTCGAGAATCTGCAGGATCACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018790.1-749s1c1
Sequence:CCGGAGTCAGTTGAGGCTCAGCAATCTCGAGATTGCTGAGCCTCAACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015193
ARC MISSION shRNA Bacterial Glycerol Stock
activity-regulated cytoskeleton-associated protein
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015193.2-1006s1c1
Sequence:CCGGCAAGAAGGAGTTCCTGCAGTACTCGAGTACTGCAGGAACTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015193.2-991s1c1
Sequence:CCGGGAACTGGGTGGAGTTCAAGAACTCGAGTTCTTGAACTCCACCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015193.2-922s1c1
Sequence:CCGGGTCCCAGATCCAGAATCACATCTCGAGATGTGATTCTGGATCTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015193.3-2147s1c1
Sequence:CCGGCCACAAAGTCTTTGCTGCTGTCTCGAGACAGCAGCAAAGACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015193.2-2746s1c1
Sequence:CCGGCCATAACCAATCCTCAAGGCTCTCGAGAGCCTTGAGGATTGGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015193.2-2125s1c1
Sequence:CCGGGAGAGTGACAACAGGTCTCAACTCGAGTTGAGACCTGTTGTCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015193
ARC MISSION shRNA shRNA Plasmid DNA
activity-regulated cytoskeleton-associated protein
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015193.2-1006s1c1
Sequence:CCGGCAAGAAGGAGTTCCTGCAGTACTCGAGTACTGCAGGAACTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015193.2-991s1c1
Sequence:CCGGGAACTGGGTGGAGTTCAAGAACTCGAGTTCTTGAACTCCACCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015193.2-922s1c1
Sequence:CCGGGTCCCAGATCCAGAATCACATCTCGAGATGTGATTCTGGATCTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015193.3-2147s1c1
Sequence:CCGGCCACAAAGTCTTTGCTGCTGTCTCGAGACAGCAGCAAAGACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015193.2-2746s1c1
Sequence:CCGGCCATAACCAATCCTCAAGGCTCTCGAGAGCCTTGAGGATTGGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015193.2-2125s1c1
Sequence:CCGGGAGAGTGACAACAGGTCTCAACTCGAGTTGAGACCTGTTGTCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015193
ARC MISSION shRNA Lentiviral Transduction Particles
activity-regulated cytoskeleton-associated protein
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015193.2-1006s1c1
Sequence:CCGGCAAGAAGGAGTTCCTGCAGTACTCGAGTACTGCAGGAACTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015193.2-991s1c1
Sequence:CCGGGAACTGGGTGGAGTTCAAGAACTCGAGTTCTTGAACTCCACCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015193.2-922s1c1
Sequence:CCGGGTCCCAGATCCAGAATCACATCTCGAGATGTGATTCTGGATCTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015193.3-2147s1c1
Sequence:CCGGCCACAAAGTCTTTGCTGCTGTCTCGAGACAGCAGCAAAGACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015193.2-2746s1c1
Sequence:CCGGCCATAACCAATCCTCAAGGCTCTCGAGAGCCTTGAGGATTGGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015193.2-2125s1c1
Sequence:CCGGGAGAGTGACAACAGGTCTCAACTCGAGTTGAGACCTGTTGTCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks