EMAIL THIS PAGE TO A FRIEND

ARCN1

archain 1

126 Gene Product Result for
Synonyms: COPD
UniProtKB ID: P48444, B4E1X2, E9PEU4, Q52M80
Gene ID:
Human(372) Summary: This gene maps in a region, which include the mixed lineage leukemia and Friend leukemia virus integration 1 genes, where multiple disease-associated chromosome translocations occur. It is an intracellular protein. Archain sequences are well conserved among eukaryotes and this protein may play a fundamental role in eukaryotic cell biology. It has similarities to heat shock proteins and clathrin-associated proteins, and may be involved in vesicle structure or trafficking. [provided by RefSeq, Jul 2008]
Mouse(213827) archain 1
Rat(300674) archain 1
chicken(770561) archain 1
cow(533078) archain 1
dog(479415) archain 1
sheep(101103008) archain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001655 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090191 MISSION® esiRNA esiRNA human ARCN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001655 Rosetta Predictions human pricing
NM_001007662 Rosetta Predictions rat pricing
NM_145985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332254 predicted 416
2 SASI_Hs01_00205402 predicted 1433
3 SASI_Hs01_00205403 predicted 338
4 SASI_Hs01_00205404 predicted 950
5 SASI_Hs01_00205405 predicted 888
6 SASI_Hs02_00332255 predicted 704
7 SASI_Hs01_00205406 predicted 1046
8 SASI_Hs01_00205407 predicted 628
9 SASI_Hs01_00205408 predicted 641
10 SASI_Hs01_00205409 predicted 754
11 SASI_Hs01_00205401 predicted 925
12 SASI_Hs01_00205410 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198788 predicted 269
2 SASI_Rn01_00099527 predicted 1627
3 SASI_Rn01_00099528 predicted 1031
4 SASI_Rn01_00099529 predicted 708
5 SASI_Rn01_00099530 predicted 1499
6 SASI_Rn01_00099531 predicted 1587
7 SASI_Rn01_00099532 predicted 359
8 SASI_Rn01_00099533 predicted 1056
9 SASI_Rn01_00099534 predicted 1016
10 SASI_Rn02_00198789 predicted 296
11 SASI_Rn01_00099535 predicted 397
12 SASI_Rn01_00099536 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128208 predicted 912
2 SASI_Mm01_00128209 predicted 1693
3 SASI_Mm02_00341493 predicted 1295
4 SASI_Mm01_00128210 predicted 1317
5 SASI_Mm02_00341494 predicted 375
6 SASI_Mm02_00341495 predicted 1424
7 SASI_Mm02_00341496 predicted 1183
8 SASI_Mm02_00341497 predicted 195
9 SASI_Mm02_00341498 predicted 401
10 SASI_Mm01_00128215 predicted 1642
11 SASI_Mm01_00128211 predicted 1040
12 SASI_Mm01_00128212 predicted 723
13 SASI_Mm01_00128213 predicted 1067
14 SASI_Mm01_00128214 predicted 874
15 SASI_Mm01_00128216 predicted 1509
16 SASI_Mm01_00128217 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145985
VALIDATED
ARCN1 MISSION shRNA Bacterial Glycerol Stock
archain 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145985.3-1297s1c1
Sequence:CCGGGATGTCAACATAGAGTACGAACTCGAGTTCGTACTCTATGTTGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145985.3-606s1c1
Sequence:CCGGGCGGCGTAAAGCAAAGGAATTCTCGAGAATTCCTTTGCTTTACGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145985.3-1632s1c1
Sequence:CCGGCACTTTCTTAGTGGACAAATACTCGAGTATTTGTCCACTAAGAAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145985.3-1631s1c1
Sequence:CCGGCCACTTTCTTAGTGGACAAATCTCGAGATTTGTCCACTAAGAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145985.3-2644s1c1
Sequence:CCGGGCCCTAAATCACTGGAGAGATCTCGAGATCTCTCCAGTGATTTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1424s21c1
Sequence:GTACCGGCGACATGACAGTCGGAGAAATCTCGAGATTTCTCCGACTGTCATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-925s21c1
Sequence:GTACCGGAGTGCATGCTCCACCTATTAACTCGAGTTAATAGGTGGAGCATGCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1278s21c1
Sequence:GTACCGGGGCCTTCGGAAAGTGGAAATGCTCGAGCATTTCCACTTTCCGAAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1638s21c1
Sequence:CCGGCCACTTTCTTAGTGGACAAATCTCGAGATTTGTCCACTAAGAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145985.4-2651s21c1
Sequence:CCGGGCCCTAAATCACTGGAGAGATCTCGAGATCTCTCCAGTGATTTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1304s21c1
Sequence:CCGGGATGTCAACATAGAGTACGAACTCGAGTTCGTACTCTATGTTGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1296s21c1
Sequence:CCGGATGGCTGTGATGTCAACATAGCTCGAGCTATGTTGACATCACAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145985
VALIDATED
ARCN1 MISSION shRNA shRNA Plasmid DNA
archain 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145985.3-1297s1c1
Sequence:CCGGGATGTCAACATAGAGTACGAACTCGAGTTCGTACTCTATGTTGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145985.3-606s1c1
Sequence:CCGGGCGGCGTAAAGCAAAGGAATTCTCGAGAATTCCTTTGCTTTACGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145985.3-1632s1c1
Sequence:CCGGCACTTTCTTAGTGGACAAATACTCGAGTATTTGTCCACTAAGAAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145985.3-1631s1c1
Sequence:CCGGCCACTTTCTTAGTGGACAAATCTCGAGATTTGTCCACTAAGAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145985.3-2644s1c1
Sequence:CCGGGCCCTAAATCACTGGAGAGATCTCGAGATCTCTCCAGTGATTTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1424s21c1
Sequence:GTACCGGCGACATGACAGTCGGAGAAATCTCGAGATTTCTCCGACTGTCATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-925s21c1
Sequence:GTACCGGAGTGCATGCTCCACCTATTAACTCGAGTTAATAGGTGGAGCATGCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1278s21c1
Sequence:GTACCGGGGCCTTCGGAAAGTGGAAATGCTCGAGCATTTCCACTTTCCGAAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1638s21c1
Sequence:CCGGCCACTTTCTTAGTGGACAAATCTCGAGATTTGTCCACTAAGAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145985.4-2651s21c1
Sequence:CCGGGCCCTAAATCACTGGAGAGATCTCGAGATCTCTCCAGTGATTTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1304s21c1
Sequence:CCGGGATGTCAACATAGAGTACGAACTCGAGTTCGTACTCTATGTTGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1296s21c1
Sequence:CCGGATGGCTGTGATGTCAACATAGCTCGAGCTATGTTGACATCACAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145985
VALIDATED
ARCN1 MISSION shRNA Lentiviral Transduction Particles
archain 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145985.3-1297s1c1
Sequence:CCGGGATGTCAACATAGAGTACGAACTCGAGTTCGTACTCTATGTTGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145985.3-606s1c1
Sequence:CCGGGCGGCGTAAAGCAAAGGAATTCTCGAGAATTCCTTTGCTTTACGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145985.3-1632s1c1
Sequence:CCGGCACTTTCTTAGTGGACAAATACTCGAGTATTTGTCCACTAAGAAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145985.3-1631s1c1
Sequence:CCGGCCACTTTCTTAGTGGACAAATCTCGAGATTTGTCCACTAAGAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145985.3-2644s1c1
Sequence:CCGGGCCCTAAATCACTGGAGAGATCTCGAGATCTCTCCAGTGATTTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1424s21c1
Sequence:GTACCGGCGACATGACAGTCGGAGAAATCTCGAGATTTCTCCGACTGTCATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-925s21c1
Sequence:GTACCGGAGTGCATGCTCCACCTATTAACTCGAGTTAATAGGTGGAGCATGCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1278s21c1
Sequence:GTACCGGGGCCTTCGGAAAGTGGAAATGCTCGAGCATTTCCACTTTCCGAAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1638s21c1
Sequence:CCGGCCACTTTCTTAGTGGACAAATCTCGAGATTTGTCCACTAAGAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145985.4-2651s21c1
Sequence:CCGGGCCCTAAATCACTGGAGAGATCTCGAGATCTCTCCAGTGATTTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1304s21c1
Sequence:CCGGGATGTCAACATAGAGTACGAACTCGAGTTCGTACTCTATGTTGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145985.4-1296s21c1
Sequence:CCGGATGGCTGTGATGTCAACATAGCTCGAGCTATGTTGACATCACAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001655
VALIDATED
ARCN1 MISSION shRNA Bacterial Glycerol Stock
archain 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001655.3-1058s1c1
Sequence:CCGGGCTTAGGATCTCAGATGACAACTCGAGTTGTCATCTGAGATCCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001655.3-195s1c1
Sequence:CCGGGCTATTGTTTCTCGACAGTTTCTCGAGAAACTGTCGAGAAACAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001655.3-630s1c1
Sequence:CCGGCGTCGTAAAGCAAAGGAATTACTCGAGTAATTCCTTTGCTTTACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001655.3-438s1c1
Sequence:CCGGGCCTTAGAAGAGAATGAAATACTCGAGTATTTCATTCTCTTCTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001655.3-1661s1c1
Sequence:CCGGCCTAGTGGATAAGTATGAAATCTCGAGATTTCATACTTATCCACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001655.4-903s21c1
Sequence:GTACCGGACCATCATGTCCTCTAGTATGCTCGAGCATACTAGAGGACATGATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001655.4-1450s21c1
Sequence:GTACCGGGACATGACAGTCGACGAAATACTCGAGTATTTCGTCGACTGTCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001655.4-1905s21c1
Sequence:GTACCGGTAAAGGGAAAGGCTGCTAATTCTCGAGAATTAGCAGCCTTTCCCTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-639s21c1
Sequence:CCGGCGTCGTAAAGCAAAGGAATTACTCGAGTAATTCCTTTGCTTTACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-1067s21c1
Sequence:CCGGGCTTAGGATCTCAGATGACAACTCGAGTTGTCATCTGAGATCCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-2005s21c1
Sequence:CCGGACCTAAGTTGCTCCTTTATTTCTCGAGAAATAAAGGAGCAACTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-240s21c1
Sequence:CCGGACTCGGATTGAGGGCTTATTACTCGAGTAATAAGCCCTCAATCCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-951s21c1
Sequence:CCGGATGCATGCTCCACCCATTAATCTCGAGATTAATGGGTGGAGCATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001655.4-699s21c1
Sequence:GTACCGGGCACCAGGATTTGGCGGATTTCTCGAGAAATCCGCCAAATCCTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001655
VALIDATED
ARCN1 MISSION shRNA shRNA Plasmid DNA
archain 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001655.3-1058s1c1
Sequence:CCGGGCTTAGGATCTCAGATGACAACTCGAGTTGTCATCTGAGATCCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001655.3-195s1c1
Sequence:CCGGGCTATTGTTTCTCGACAGTTTCTCGAGAAACTGTCGAGAAACAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001655.3-630s1c1
Sequence:CCGGCGTCGTAAAGCAAAGGAATTACTCGAGTAATTCCTTTGCTTTACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001655.3-438s1c1
Sequence:CCGGGCCTTAGAAGAGAATGAAATACTCGAGTATTTCATTCTCTTCTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001655.3-1661s1c1
Sequence:CCGGCCTAGTGGATAAGTATGAAATCTCGAGATTTCATACTTATCCACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001655.4-903s21c1
Sequence:GTACCGGACCATCATGTCCTCTAGTATGCTCGAGCATACTAGAGGACATGATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001655.4-1450s21c1
Sequence:GTACCGGGACATGACAGTCGACGAAATACTCGAGTATTTCGTCGACTGTCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001655.4-1905s21c1
Sequence:GTACCGGTAAAGGGAAAGGCTGCTAATTCTCGAGAATTAGCAGCCTTTCCCTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-639s21c1
Sequence:CCGGCGTCGTAAAGCAAAGGAATTACTCGAGTAATTCCTTTGCTTTACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-1067s21c1
Sequence:CCGGGCTTAGGATCTCAGATGACAACTCGAGTTGTCATCTGAGATCCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-2005s21c1
Sequence:CCGGACCTAAGTTGCTCCTTTATTTCTCGAGAAATAAAGGAGCAACTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-240s21c1
Sequence:CCGGACTCGGATTGAGGGCTTATTACTCGAGTAATAAGCCCTCAATCCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-951s21c1
Sequence:CCGGATGCATGCTCCACCCATTAATCTCGAGATTAATGGGTGGAGCATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001655.4-699s21c1
Sequence:GTACCGGGCACCAGGATTTGGCGGATTTCTCGAGAAATCCGCCAAATCCTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001655
VALIDATED
ARCN1 MISSION shRNA Lentiviral Transduction Particles
archain 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001655.3-1058s1c1
Sequence:CCGGGCTTAGGATCTCAGATGACAACTCGAGTTGTCATCTGAGATCCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001655.3-195s1c1
Sequence:CCGGGCTATTGTTTCTCGACAGTTTCTCGAGAAACTGTCGAGAAACAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001655.3-630s1c1
Sequence:CCGGCGTCGTAAAGCAAAGGAATTACTCGAGTAATTCCTTTGCTTTACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001655.3-438s1c1
Sequence:CCGGGCCTTAGAAGAGAATGAAATACTCGAGTATTTCATTCTCTTCTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001655.3-1661s1c1
Sequence:CCGGCCTAGTGGATAAGTATGAAATCTCGAGATTTCATACTTATCCACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001655.4-903s21c1
Sequence:GTACCGGACCATCATGTCCTCTAGTATGCTCGAGCATACTAGAGGACATGATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001655.4-1450s21c1
Sequence:GTACCGGGACATGACAGTCGACGAAATACTCGAGTATTTCGTCGACTGTCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001655.4-1905s21c1
Sequence:GTACCGGTAAAGGGAAAGGCTGCTAATTCTCGAGAATTAGCAGCCTTTCCCTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-639s21c1
Sequence:CCGGCGTCGTAAAGCAAAGGAATTACTCGAGTAATTCCTTTGCTTTACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-1067s21c1
Sequence:CCGGGCTTAGGATCTCAGATGACAACTCGAGTTGTCATCTGAGATCCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-2005s21c1
Sequence:CCGGACCTAAGTTGCTCCTTTATTTCTCGAGAAATAAAGGAGCAACTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-240s21c1
Sequence:CCGGACTCGGATTGAGGGCTTATTACTCGAGTAATAAGCCCTCAATCCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001655.4-951s21c1
Sequence:CCGGATGCATGCTCCACCCATTAATCTCGAGATTAATGGGTGGAGCATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001655.4-699s21c1
Sequence:GTACCGGGCACCAGGATTTGGCGGATTTCTCGAGAAATCCGCCAAATCCTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)