EMAIL THIS PAGE TO A FRIEND

AREG

amphiregulin

76 Gene Product Result for
Synonyms: AR CRDGF SDGF
UniProtKB ID: P15514
Gene ID:
Human(374) Summary: The protein encoded by this gene is a member of the epidermal growth factor family. It is an autocrine growth factor as well as a mitogen for astrocytes, Schwann cells, and fibroblasts. It is related to epidermal growth factor (EGF) and transforming growth factor alpha (TGF-alpha). This protein interacts with the EGF/TGF-alpha receptor to promote the growth of normal epithelial cells and inhibits the growth of certain aggressive carcinoma cell lines. This encoded protein is associated with a psoriasis-like skin phenotype. [provided by RefSeq, Jul 2008]
Mouse(11839) amphiregulin
Rat(29183) amphiregulin
sheep(443427) amphiregulin
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001657 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001657 Rosetta Predictions human pricing
NM_017123 Rosetta Predictions rat pricing
NM_009704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332258 predicted 307
2 SASI_Hs01_00014263 predicted 296
3 SASI_Hs01_00014264 predicted 842
4 SASI_Hs01_00014266 predicted 302
5 SASI_Hs01_00014267 predicted 929
6 SASI_Hs01_00014268 predicted 856
7 SASI_Hs01_00014269 predicted 279
8 SASI_Hs01_00014270 predicted 877
9 SASI_Hs01_00014271 predicted 277
10 SASI_Hs01_00014272 predicted 872
11 SASI_Hs01_00014265 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047200 predicted 880
2 SASI_Rn01_00047201 predicted 784
3 SASI_Rn01_00047202 predicted 771
4 SASI_Rn01_00047203 predicted 781
5 SASI_Rn01_00047204 predicted 229
6 SASI_Rn01_00047205 predicted 217
7 SASI_Rn01_00047206 predicted 815
8 SASI_Rn01_00047207 predicted 901
9 SASI_Rn01_00047208 predicted 817
10 SASI_Rn01_00047209 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316835 predicted 245
2 SASI_Mm02_00316836 predicted 252
3 SASI_Mm02_00316837 predicted 814
4 SASI_Mm02_00316838 predicted 828
5 SASI_Mm02_00316839 predicted 824
6 SASI_Mm02_00316840 predicted 853
7 SASI_Mm02_00316841 predicted 819
8 SASI_Mm02_00316842 predicted 847
9 SASI_Mm02_00316843 predicted 841
10 SASI_Mm02_00316844 predicted 889
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001657
AREG MISSION shRNA Bacterial Glycerol Stock
amphiregulin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001657.2-673s21c1
Sequence:CCGGATTCACGGAGAATGCAAATATCTCGAGATATTTGCATTCTCCGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001657.2-517s21c1
Sequence:CCGGAGAGTTGAACAGGTAGTTAAGCTCGAGCTTAACTACCTGTTCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001657.2-260s21c1
Sequence:CCGGTACTCGGCTCAGGCCATTATGCTCGAGCATAATGGCCTGAGCCGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001657.2-950s21c1
Sequence:CCGGATGTACATGCTATAGCATAACCTCGAGGTTATGCTATAGCATGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001657.2-1039s21c1
Sequence:CCGGCCTCTTTCCAGTGGATCATAACTCGAGTTATGATCCACTGGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001657.2-1004s1c1
Sequence:CCGGCACTGCCAAGTCATAGCCATACTCGAGTATGGCTATGACTTGGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001657.2-490s1c1
Sequence:CCGGCCTGGCTATATTGTCGATGATCTCGAGATCATCGACAATATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001657.2-919s1c1
Sequence:CCGGGAACGAAAGAAACTTCGACAACTCGAGTTGTCGAAGTTTCTTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001657.2-478s1c1
Sequence:CCGGGAACCACAAATACCTGGCTATCTCGAGATAGCCAGGTATTTGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001657.2-445s1c1
Sequence:CCGGGCCGACTATGACTACTCAGAACTCGAGTTCTGAGTAGTCATAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001657
AREG MISSION shRNA shRNA Plasmid DNA
amphiregulin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001657.2-673s21c1
Sequence:CCGGATTCACGGAGAATGCAAATATCTCGAGATATTTGCATTCTCCGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001657.2-517s21c1
Sequence:CCGGAGAGTTGAACAGGTAGTTAAGCTCGAGCTTAACTACCTGTTCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001657.2-260s21c1
Sequence:CCGGTACTCGGCTCAGGCCATTATGCTCGAGCATAATGGCCTGAGCCGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001657.2-950s21c1
Sequence:CCGGATGTACATGCTATAGCATAACCTCGAGGTTATGCTATAGCATGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001657.2-1039s21c1
Sequence:CCGGCCTCTTTCCAGTGGATCATAACTCGAGTTATGATCCACTGGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001657.2-1004s1c1
Sequence:CCGGCACTGCCAAGTCATAGCCATACTCGAGTATGGCTATGACTTGGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001657.2-490s1c1
Sequence:CCGGCCTGGCTATATTGTCGATGATCTCGAGATCATCGACAATATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001657.2-919s1c1
Sequence:CCGGGAACGAAAGAAACTTCGACAACTCGAGTTGTCGAAGTTTCTTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001657.2-478s1c1
Sequence:CCGGGAACCACAAATACCTGGCTATCTCGAGATAGCCAGGTATTTGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001657.2-445s1c1
Sequence:CCGGGCCGACTATGACTACTCAGAACTCGAGTTCTGAGTAGTCATAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001657
AREG MISSION shRNA Lentiviral Transduction Particles
amphiregulin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001657.2-673s21c1
Sequence:CCGGATTCACGGAGAATGCAAATATCTCGAGATATTTGCATTCTCCGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001657.2-517s21c1
Sequence:CCGGAGAGTTGAACAGGTAGTTAAGCTCGAGCTTAACTACCTGTTCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001657.2-260s21c1
Sequence:CCGGTACTCGGCTCAGGCCATTATGCTCGAGCATAATGGCCTGAGCCGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001657.2-950s21c1
Sequence:CCGGATGTACATGCTATAGCATAACCTCGAGGTTATGCTATAGCATGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001657.2-1039s21c1
Sequence:CCGGCCTCTTTCCAGTGGATCATAACTCGAGTTATGATCCACTGGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001657.2-1004s1c1
Sequence:CCGGCACTGCCAAGTCATAGCCATACTCGAGTATGGCTATGACTTGGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001657.2-490s1c1
Sequence:CCGGCCTGGCTATATTGTCGATGATCTCGAGATCATCGACAATATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001657.2-919s1c1
Sequence:CCGGGAACGAAAGAAACTTCGACAACTCGAGTTGTCGAAGTTTCTTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001657.2-478s1c1
Sequence:CCGGGAACCACAAATACCTGGCTATCTCGAGATAGCCAGGTATTTGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001657.2-445s1c1
Sequence:CCGGGCCGACTATGACTACTCAGAACTCGAGTTCTGAGTAGTCATAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009704
VALIDATED
AREG MISSION shRNA Bacterial Glycerol Stock
amphiregulin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009704.3-449s21c1
Sequence:CCGGCCACAAATATCCGGCTATATTCTCGAGAATATAGCCGGATATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009704.3-649s21c1
Sequence:CCGGCGAATGCAGATACATCGAGAACTCGAGTTCTCGATGTATCTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009704.3-249s21c1
Sequence:CCGGTCTTAGGCTCAGGCCATTATGCTCGAGCATAATGGCCTGAGCCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009704.3-978s21c1
Sequence:CCGGTTGCCAAGCCACACCGGAAATCTCGAGATTTCCGGTGTGGCTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009704.3-859s21c1
Sequence:CCGGGAAACGATACTTCAGGGAATACTCGAGTATTCCCTGAAGTATCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009704.2-449s1c1
Sequence:CCGGCCACAAATATCCGGCTATATTCTCGAGAATATAGCCGGATATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009704.2-649s1c1
Sequence:CCGGCGAATGCAGATACATCGAGAACTCGAGTTCTCGATGTATCTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009704.2-947s1c1
Sequence:CCGGCTGAGGACAATGCAGGGTAAACTCGAGTTTACCCTGCATTGTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009704.2-459s1c1
Sequence:CCGGCCGGCTATATTATAGATGATTCTCGAGAATCATCTATAATATAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009704.2-859s1c1
Sequence:CCGGGAAACGATACTTCAGGGAATACTCGAGTATTCCCTGAAGTATCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009704
VALIDATED
AREG MISSION shRNA shRNA Plasmid DNA
amphiregulin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009704.3-449s21c1
Sequence:CCGGCCACAAATATCCGGCTATATTCTCGAGAATATAGCCGGATATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009704.3-649s21c1
Sequence:CCGGCGAATGCAGATACATCGAGAACTCGAGTTCTCGATGTATCTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009704.3-249s21c1
Sequence:CCGGTCTTAGGCTCAGGCCATTATGCTCGAGCATAATGGCCTGAGCCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009704.3-978s21c1
Sequence:CCGGTTGCCAAGCCACACCGGAAATCTCGAGATTTCCGGTGTGGCTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009704.3-859s21c1
Sequence:CCGGGAAACGATACTTCAGGGAATACTCGAGTATTCCCTGAAGTATCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009704.2-449s1c1
Sequence:CCGGCCACAAATATCCGGCTATATTCTCGAGAATATAGCCGGATATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009704.2-649s1c1
Sequence:CCGGCGAATGCAGATACATCGAGAACTCGAGTTCTCGATGTATCTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009704.2-947s1c1
Sequence:CCGGCTGAGGACAATGCAGGGTAAACTCGAGTTTACCCTGCATTGTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009704.2-459s1c1
Sequence:CCGGCCGGCTATATTATAGATGATTCTCGAGAATCATCTATAATATAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009704.2-859s1c1
Sequence:CCGGGAAACGATACTTCAGGGAATACTCGAGTATTCCCTGAAGTATCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009704
VALIDATED
AREG MISSION shRNA Lentiviral Transduction Particles
amphiregulin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009704.3-449s21c1
Sequence:CCGGCCACAAATATCCGGCTATATTCTCGAGAATATAGCCGGATATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009704.3-649s21c1
Sequence:CCGGCGAATGCAGATACATCGAGAACTCGAGTTCTCGATGTATCTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009704.3-249s21c1
Sequence:CCGGTCTTAGGCTCAGGCCATTATGCTCGAGCATAATGGCCTGAGCCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009704.3-978s21c1
Sequence:CCGGTTGCCAAGCCACACCGGAAATCTCGAGATTTCCGGTGTGGCTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009704.3-859s21c1
Sequence:CCGGGAAACGATACTTCAGGGAATACTCGAGTATTCCCTGAAGTATCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009704.2-449s1c1
Sequence:CCGGCCACAAATATCCGGCTATATTCTCGAGAATATAGCCGGATATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009704.2-649s1c1
Sequence:CCGGCGAATGCAGATACATCGAGAACTCGAGTTCTCGATGTATCTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009704.2-947s1c1
Sequence:CCGGCTGAGGACAATGCAGGGTAAACTCGAGTTTACCCTGCATTGTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009704.2-459s1c1
Sequence:CCGGCCGGCTATATTATAGATGATTCTCGAGAATCATCTATAATATAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009704.2-859s1c1
Sequence:CCGGGAAACGATACTTCAGGGAATACTCGAGTATTCCCTGAAGTATCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks