EMAIL THIS PAGE TO A FRIEND

AREL1

apoptosis resistant E3 ubiquitin protein ligase 1

153 Gene Product Result for
Synonyms: KIAA0317
UniProtKB ID: O15033, B4E2C7, Q7LDY1, Q8IYY9
Gene ID:
Mouse(68497) apoptosis resistant E3 ubiquitin protein ligase 1
Rat(299197) apoptosis resistant E3 ubiquitin protein ligase 1
dog(490785) apoptosis resistant E3 ubiquitin protein ligase 1
cow(539472) apoptosis resistant E3 ubiquitin protein ligase 1
naked mole-rat(101698540) apoptosis resistant E3 ubiquitin protein ligase 1
domestic guinea pig(100733892) apoptosis resistant E3 ubiquitin protein ligase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178065 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178065 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178065 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014821 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039479 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075231 MISSION® esiRNA esiRNA human KIAA0317 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039479 Rosetta Predictions human pricing
NM_001106744 Rosetta Predictions rat pricing
NM_178065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032079 predicted 1129
2 SASI_Hs01_00032080 predicted 2086
3 SASI_Hs01_00032081 predicted 1092
4 SASI_Hs01_00032082 predicted 508
5 SASI_Hs01_00032083 predicted 562
6 SASI_Hs01_00032085 predicted 2259
7 SASI_Hs01_00032087 predicted 2038
8 SASI_Hs02_00308524 predicted 3023
9 SASI_Hs01_00032088 predicted 2301
10 SASI_Hs02_00308525 predicted 1199
11 SASI_Hs01_00032084 predicted 983
12 SASI_Hs01_00032086 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221968 predicted 1928
2 SASI_Rn02_00221969 predicted 223
3 SASI_Rn02_00221970 predicted 593
4 SASI_Rn02_00221971 predicted 1050
5 SASI_Rn02_00221972 predicted 2672
6 SASI_Rn02_00221973 predicted 1966
7 SASI_Rn02_00221974 predicted 2719
8 SASI_Rn02_00221975 predicted 2504
9 SASI_Rn02_00221976 predicted 748
10 SASI_Rn02_00221977 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073268 predicted 2037
2 SASI_Mm01_00073269 predicted 1519
3 SASI_Mm01_00073270 predicted 2410
4 SASI_Mm01_00073271 predicted 692
5 SASI_Mm02_00348526 predicted 2265
6 SASI_Mm01_00073273 predicted 710
7 SASI_Mm01_00073274 predicted 3185
8 SASI_Mm01_00073275 predicted 2090
9 SASI_Mm01_00073276 predicted 1420
10 SASI_Mm01_00073277 predicted 1264
11 SASI_Mm01_00073272 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178065
AREL1 MISSION shRNA Bacterial Glycerol Stock
apoptosis resistant E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178065.3-3505s1c1
Sequence:CCGGCCGACTTACATAGTTTGTTAACTCGAGTTAACAAACTATGTAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178065.3-994s1c1
Sequence:CCGGCCCATCAATAATGGCGAATTTCTCGAGAAATTCGCCATTATTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178065.3-1842s1c1
Sequence:CCGGGCGCTTGAAGATGTATGAGTTCTCGAGAACTCATACATCTTCAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178065.3-561s1c1
Sequence:CCGGGCCGAATTCTAACGTGGTGAACTCGAGTTCACCACGTTAGAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178065.3-1958s1c1
Sequence:CCGGCCCAAATCATAGGACTCCGTACTCGAGTACGGAGTCCTATGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178065
AREL1 MISSION shRNA shRNA Plasmid DNA
apoptosis resistant E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178065.3-3505s1c1
Sequence:CCGGCCGACTTACATAGTTTGTTAACTCGAGTTAACAAACTATGTAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178065.3-994s1c1
Sequence:CCGGCCCATCAATAATGGCGAATTTCTCGAGAAATTCGCCATTATTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178065.3-1842s1c1
Sequence:CCGGGCGCTTGAAGATGTATGAGTTCTCGAGAACTCATACATCTTCAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178065.3-561s1c1
Sequence:CCGGGCCGAATTCTAACGTGGTGAACTCGAGTTCACCACGTTAGAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178065.3-1958s1c1
Sequence:CCGGCCCAAATCATAGGACTCCGTACTCGAGTACGGAGTCCTATGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178065
AREL1 MISSION shRNA Lentiviral Transduction Particles
apoptosis resistant E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178065.3-3505s1c1
Sequence:CCGGCCGACTTACATAGTTTGTTAACTCGAGTTAACAAACTATGTAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178065.3-994s1c1
Sequence:CCGGCCCATCAATAATGGCGAATTTCTCGAGAAATTCGCCATTATTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178065.3-1842s1c1
Sequence:CCGGGCGCTTGAAGATGTATGAGTTCTCGAGAACTCATACATCTTCAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178065.3-561s1c1
Sequence:CCGGGCCGAATTCTAACGTGGTGAACTCGAGTTCACCACGTTAGAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178065.3-1958s1c1
Sequence:CCGGCCCAAATCATAGGACTCCGTACTCGAGTACGGAGTCCTATGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014821
VALIDATED
AREL1 MISSION shRNA Bacterial Glycerol Stock
apoptosis resistant E3 ubiquitin protein ligase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014821.x-1750s1c1
Sequence:CCGGCGCTCCCTGCATAAGAACATACTCGAGTATGTTCTTATGCAGGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014821.x-2228s1c1
Sequence:CCGGCCCAAATCATAGGACTGCGTACTCGAGTACGCAGTCCTATGATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014821.x-831s1c1
Sequence:CCGGGCCCAATTCCAACGTAGTAAACTCGAGTTTACTACGTTGGAATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014821.x-4476s1c1
Sequence:CCGGCGCAGTCATCATTTGTCCTTTCTCGAGAAAGGACAAATGATGACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014821.x-1992s1c1
Sequence:CCGGCCGGGAATGGTTTGAGCTAATCTCGAGATTAGCTCAAACCATTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014821
VALIDATED
AREL1 MISSION shRNA shRNA Plasmid DNA
apoptosis resistant E3 ubiquitin protein ligase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014821.x-1750s1c1
Sequence:CCGGCGCTCCCTGCATAAGAACATACTCGAGTATGTTCTTATGCAGGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014821.x-2228s1c1
Sequence:CCGGCCCAAATCATAGGACTGCGTACTCGAGTACGCAGTCCTATGATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014821.x-831s1c1
Sequence:CCGGGCCCAATTCCAACGTAGTAAACTCGAGTTTACTACGTTGGAATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014821.x-4476s1c1
Sequence:CCGGCGCAGTCATCATTTGTCCTTTCTCGAGAAAGGACAAATGATGACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014821.x-1992s1c1
Sequence:CCGGCCGGGAATGGTTTGAGCTAATCTCGAGATTAGCTCAAACCATTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014821
VALIDATED
AREL1 MISSION shRNA Lentiviral Transduction Particles
apoptosis resistant E3 ubiquitin protein ligase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014821.x-1750s1c1
Sequence:CCGGCGCTCCCTGCATAAGAACATACTCGAGTATGTTCTTATGCAGGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014821.x-2228s1c1
Sequence:CCGGCCCAAATCATAGGACTGCGTACTCGAGTACGCAGTCCTATGATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014821.x-831s1c1
Sequence:CCGGGCCCAATTCCAACGTAGTAAACTCGAGTTTACTACGTTGGAATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014821.x-4476s1c1
Sequence:CCGGCGCAGTCATCATTTGTCCTTTCTCGAGAAAGGACAAATGATGACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014821.x-1992s1c1
Sequence:CCGGCCGGGAATGGTTTGAGCTAATCTCGAGATTAGCTCAAACCATTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039479
VALIDATED
AREL1 MISSION shRNA Bacterial Glycerol Stock
apoptosis resistant E3 ubiquitin protein ligase 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000280104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039479.1-2026s21c1
Sequence:CCGGCCGGGAATGGTTTGAGCTAATCTCGAGATTAGCTCAAACCATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039479.1-2262s21c1
Sequence:CCGGCCCAAATCATAGGACTGCGTACTCGAGTACGCAGTCCTATGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039479.1-4511s21c1
Sequence:CCGGCGCAGTCATCATTTGTCCTTTCTCGAGAAAGGACAAATGATGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039479.1-865s21c1
Sequence:CCGGGCCCAATTCCAACGTAGTAAACTCGAGTTTACTACGTTGGAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039479
VALIDATED
AREL1 MISSION shRNA shRNA Plasmid DNA
apoptosis resistant E3 ubiquitin protein ligase 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000280104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039479.1-2026s21c1
Sequence:CCGGCCGGGAATGGTTTGAGCTAATCTCGAGATTAGCTCAAACCATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039479.1-2262s21c1
Sequence:CCGGCCCAAATCATAGGACTGCGTACTCGAGTACGCAGTCCTATGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039479.1-4511s21c1
Sequence:CCGGCGCAGTCATCATTTGTCCTTTCTCGAGAAAGGACAAATGATGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039479.1-865s21c1
Sequence:CCGGGCCCAATTCCAACGTAGTAAACTCGAGTTTACTACGTTGGAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039479
VALIDATED
AREL1 MISSION shRNA Lentiviral Transduction Particles
apoptosis resistant E3 ubiquitin protein ligase 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000280104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039479.1-2026s21c1
Sequence:CCGGCCGGGAATGGTTTGAGCTAATCTCGAGATTAGCTCAAACCATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039479.1-2262s21c1
Sequence:CCGGCCCAAATCATAGGACTGCGTACTCGAGTACGCAGTCCTATGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039479.1-4511s21c1
Sequence:CCGGCGCAGTCATCATTTGTCCTTTCTCGAGAAAGGACAAATGATGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039479.1-865s21c1
Sequence:CCGGGCCCAATTCCAACGTAGTAAACTCGAGTTTACTACGTTGGAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks