EMAIL THIS PAGE TO A FRIEND

ARF1

ADP-ribosylation factor 1

123 Gene Product Result for
UniProtKB ID: P84077, P10947, P32889
Gene ID:
Human(375) Summary: ADP-ribosylation factor 1 (ARF1) is a member of the human ARF gene family. The family members encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking as activators of phospholipase D. The gene products, including 6 ARF proteins and 11 ARF-like proteins, constitute a family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2 and ARF3), class II (ARF4 and ARF5) and class III (ARF6), and members of each class share a common gene organization. The ARF1 protein is localized to the Golgi apparatus and has a central role in intra-Golgi transport. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11840) ADP-ribosylation factor 1
Rat(64310) ADP-ribosylation factor 1
Zebrafish(114428) ADP-ribosylation factor 1
domestic cat(101100027) ADP-ribosylation factor 1
cow(338058) ADP-ribosylation factor 1
dog(607365) ADP-ribosylation factor 1
Thale Cress(838957) ADP-ribosylation factor 1
chicken(420398) ADP-ribosylation factor 1
Thale Cress(842268) auxin response factor 1
domestic guinea pig(100716295) ADP-ribosylation factor 1
naked mole-rat(101716414) ADP-ribosylation factor 1
sheep(100302302) ADP-ribosylation factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001658 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024226 Rosetta Predictions human pricing
NM_001024227 Rosetta Predictions human pricing
NM_001024228 Rosetta Predictions human pricing
NM_001658 Rosetta Predictions human pricing
NM_022518 Rosetta Predictions rat pricing
NM_001130408 Rosetta Predictions mouse pricing
NM_007476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307120 predicted 483
2 SASI_Hs01_00010812 predicted 1114
3 SASI_Hs02_00307121 predicted 793
4 SASI_Hs01_00010814 predicted 731
5 SASI_Hs01_00010816 predicted 1231
6 SASI_Hs02_00307122 predicted 963
7 SASI_Hs01_00010817 predicted 978
8 SASI_Hs02_00307123 predicted 488
9 SASI_Hs02_00307124 predicted 850
10 SASI_Hs02_00307125 predicted 473
11 SASI_Hs01_00010811 predicted 535
12 SASI_Hs01_00010813 predicted 1129
13 SASI_Hs01_00010815 predicted 750
14 SASI_Hs01_00010818 predicted 628
15 SASI_Hs01_00010819 predicted 806
16 SASI_Hs01_00010820 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307126 predicted 515
2 SASI_Hs01_00070753 predicted 1144
3 SASI_Hs02_00307127 predicted 826
4 SASI_Hs01_00070755 predicted 765
5 SASI_Hs01_00070757 predicted 1267
6 SASI_Hs02_00307128 predicted 1004
7 SASI_Hs01_00070758 predicted 1012
8 SASI_Hs02_00307129 predicted 521
9 SASI_Hs02_00307130 predicted 884
10 SASI_Hs02_00307131 predicted 515
11 SASI_Hs01_00070752 predicted 576
12 SASI_Hs01_00070754 predicted 1157
13 SASI_Hs01_00070756 predicted 787
14 SASI_Hs01_00070759 predicted 665
15 SASI_Hs01_00070760 predicted 850
16 SASI_Hs01_00070761 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307132 predicted 491
2 SASI_Hs01_00120123 predicted 1131
3 SASI_Hs02_00307133 predicted 802
4 SASI_Hs01_00120125 predicted 744
5 SASI_Hs01_00120127 predicted 1249
6 SASI_Hs02_00307134 predicted 983
7 SASI_Hs01_00120128 predicted 989
8 SASI_Hs02_00307135 predicted 493
9 SASI_Hs02_00307136 predicted 865
10 SASI_Hs02_00307137 predicted 490
11 SASI_Hs01_00120122 predicted 547
12 SASI_Hs01_00120124 predicted 1140
13 SASI_Hs01_00120126 predicted 765
14 SASI_Hs01_00120129 predicted 636
15 SASI_Hs01_00120130 predicted 822
16 SASI_Hs01_00120131 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332259 predicted 398
2 SASI_Hs01_00153256 predicted 1028
3 SASI_Hs02_00332260 predicted 706
4 SASI_Hs01_00153258 predicted 639
5 SASI_Hs01_00153260 predicted 1152
6 SASI_Hs02_00332261 predicted 884
7 SASI_Hs01_00153261 predicted 894
8 SASI_Hs02_00332262 predicted 399
9 SASI_Hs02_00332263 predicted 763
10 SASI_Hs02_00332264 predicted 391
11 SASI_Hs01_00153255 predicted 452
12 SASI_Hs01_00153257 predicted 1040
13 SASI_Hs01_00153259 predicted 659
14 SASI_Hs01_00153262 predicted 538
15 SASI_Hs01_00153263 predicted 723
16 SASI_Hs01_00153264 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263262 predicted 571
2 SASI_Rn02_00263263 predicted 570
3 SASI_Rn02_00263264 predicted 375
4 SASI_Rn01_00064764 predicted 328
5 SASI_Rn02_00263265 predicted 566
6 SASI_Rn01_00064767 predicted 237
7 SASI_Rn02_00263266 predicted 228
8 SASI_Rn02_00263267 predicted 229
9 SASI_Rn02_00263268 predicted 468
10 SASI_Rn01_00064765 predicted 416
11 SASI_Rn01_00064766 predicted 355
12 SASI_Rn01_00064768 predicted 1080
13 SASI_Rn01_00064769 predicted 967
14 SASI_Rn01_00064770 predicted 207
15 SASI_Rn01_00064771 predicted 840
16 SASI_Rn01_00064772 predicted 1048
17 SASI_Rn01_00064773 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311148 predicted 578
2 SASI_Mm02_00311149 predicted 486
3 SASI_Mm02_00311150 predicted 668
4 SASI_Mm02_00311151 predicted 1127
5 SASI_Mm02_00311152 predicted 715
6 SASI_Mm02_00311153 predicted 609
7 SASI_Mm02_00311154 predicted 668
8 SASI_Mm02_00311155 predicted 588
9 SASI_Mm02_00311156 predicted 719
10 SASI_Mm02_00311157 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311735 predicted 389
2 SASI_Mm02_00311736 predicted 290
3 SASI_Mm01_00149635 predicted 471
4 SASI_Mm01_00149636 predicted 937
5 SASI_Mm01_00149640 predicted 520
6 SASI_Mm02_00311737 predicted 422
7 SASI_Mm02_00311738 predicted 474
8 SASI_Mm02_00311739 predicted 396
9 SASI_Mm02_00311740 predicted 531
10 SASI_Mm02_00311741 predicted 291
11 SASI_Mm01_00149632 predicted 573
12 SASI_Mm01_00149633 predicted 1061
13 SASI_Mm01_00149634 predicted 950
14 SASI_Mm01_00149637 predicted 1027
15 SASI_Mm01_00149638 predicted 714
16 SASI_Mm01_00149639 predicted 1080
17 SASI_Mm01_00149641 predicted 596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007476
VALIDATED
ARF1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007476.3-291s21c1
Sequence:CCGGGAGACTGTTGAATACAAGAATCTCGAGATTCTTGTATTCAACAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007476.3-635s21c1
Sequence:CCGGAGGACTAGATTGGCTGTCTAACTCGAGTTAGACAGCCAATCTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007476.3-213s21c1
Sequence:CCGGGCAGGGAAGACAACAATTCTACTCGAGTAGAATTGTTGTCTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007476.3-483s21c1
Sequence:CCGGGATGCTGTTCTCTTGGTGTTTCTCGAGAAACACCAAGAGAACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007476.3-1513s21c1
Sequence:CCGGCCCATCTCCATGTGTGAAGTACTCGAGTACTTCACACATGGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-156s1c1
Sequence:CCGGGCAGGGAAGACAACAATTCTACTCGAGTAGAATTGTTGTCTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-234s1c1
Sequence:CCGGGAGACTGTTGAATACAAGAATCTCGAGATTCTTGTATTCAACAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-578s1c1
Sequence:CCGGAGGACTAGATTGGCTGTCTAACTCGAGTTAGACAGCCAATCTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-426s1c1
Sequence:CCGGGATGCTGTTCTCTTGGTGTTTCTCGAGAAACACCAAGAGAACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-1456s1c1
Sequence:CCGGCCCATCTCCATGTGTGAAGTACTCGAGTACTTCACACATGGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007476
VALIDATED
ARF1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007476.3-291s21c1
Sequence:CCGGGAGACTGTTGAATACAAGAATCTCGAGATTCTTGTATTCAACAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007476.3-635s21c1
Sequence:CCGGAGGACTAGATTGGCTGTCTAACTCGAGTTAGACAGCCAATCTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007476.3-213s21c1
Sequence:CCGGGCAGGGAAGACAACAATTCTACTCGAGTAGAATTGTTGTCTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007476.3-483s21c1
Sequence:CCGGGATGCTGTTCTCTTGGTGTTTCTCGAGAAACACCAAGAGAACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007476.3-1513s21c1
Sequence:CCGGCCCATCTCCATGTGTGAAGTACTCGAGTACTTCACACATGGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-156s1c1
Sequence:CCGGGCAGGGAAGACAACAATTCTACTCGAGTAGAATTGTTGTCTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-234s1c1
Sequence:CCGGGAGACTGTTGAATACAAGAATCTCGAGATTCTTGTATTCAACAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-578s1c1
Sequence:CCGGAGGACTAGATTGGCTGTCTAACTCGAGTTAGACAGCCAATCTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-426s1c1
Sequence:CCGGGATGCTGTTCTCTTGGTGTTTCTCGAGAAACACCAAGAGAACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-1456s1c1
Sequence:CCGGCCCATCTCCATGTGTGAAGTACTCGAGTACTTCACACATGGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007476
VALIDATED
ARF1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007476.3-291s21c1
Sequence:CCGGGAGACTGTTGAATACAAGAATCTCGAGATTCTTGTATTCAACAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007476.3-635s21c1
Sequence:CCGGAGGACTAGATTGGCTGTCTAACTCGAGTTAGACAGCCAATCTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007476.3-213s21c1
Sequence:CCGGGCAGGGAAGACAACAATTCTACTCGAGTAGAATTGTTGTCTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007476.3-483s21c1
Sequence:CCGGGATGCTGTTCTCTTGGTGTTTCTCGAGAAACACCAAGAGAACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007476.3-1513s21c1
Sequence:CCGGCCCATCTCCATGTGTGAAGTACTCGAGTACTTCACACATGGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-156s1c1
Sequence:CCGGGCAGGGAAGACAACAATTCTACTCGAGTAGAATTGTTGTCTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-234s1c1
Sequence:CCGGGAGACTGTTGAATACAAGAATCTCGAGATTCTTGTATTCAACAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-578s1c1
Sequence:CCGGAGGACTAGATTGGCTGTCTAACTCGAGTTAGACAGCCAATCTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-426s1c1
Sequence:CCGGGATGCTGTTCTCTTGGTGTTTCTCGAGAAACACCAAGAGAACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007476.2-1456s1c1
Sequence:CCGGCCCATCTCCATGTGTGAAGTACTCGAGTACTTCACACATGGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001658
VALIDATED
ARF1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001658.3-1156s21c1
Sequence:CCGGCCTAGCATAGATTTGCAGTTACTCGAGTAACTGCAAATCTATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001658.3-503s21c1
Sequence:CCGGCCTCCTGGTGTTCGCCAACAACTCGAGTTGTTGGCGAACACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001658.3-230s21c1
Sequence:CCGGGAAGACCACGATCCTCTACAACTCGAGTTGTAGAGGATCGTGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001658.3-578s21c1
Sequence:CCGGGCACTCACTACGCCACAGGAACTCGAGTTCCTGTGGCGTAGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001658.3-425s21c1
Sequence:CCGGCAATGACAGAGAGCGTGTGAACTCGAGTTCACACGCTCTCTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001658.x-249s1c1
Sequence:CCGGCAAGAACATCAGCTTCACTGTCTCGAGACAGTGAAGCTGATGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.x-1182s1c1
Sequence:CCGGCAATTCTGCATGGTCACAGTACTCGAGTACTGTGACCATGCAGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-510s1c1
Sequence:CCGGGCACTCACTACGCCACAGGAACTCGAGTTCCTGTGGCGTAGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-1086s1c1
Sequence:CCGGCCTAGCATAGATTTGCAGTTACTCGAGTAACTGCAAATCTATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-162s1c1
Sequence:CCGGGAAGACCACGATCCTCTACAACTCGAGTTGTAGAGGATCGTGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-435s1c1
Sequence:CCGGCCTCCTGGTGTTCGCCAACAACTCGAGTTGTTGGCGAACACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-357s1c1
Sequence:CCGGCAATGACAGAGAGCGTGTGAACTCGAGTTCACACGCTCTCTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001658
VALIDATED
ARF1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001658.3-1156s21c1
Sequence:CCGGCCTAGCATAGATTTGCAGTTACTCGAGTAACTGCAAATCTATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001658.3-503s21c1
Sequence:CCGGCCTCCTGGTGTTCGCCAACAACTCGAGTTGTTGGCGAACACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001658.3-230s21c1
Sequence:CCGGGAAGACCACGATCCTCTACAACTCGAGTTGTAGAGGATCGTGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001658.3-578s21c1
Sequence:CCGGGCACTCACTACGCCACAGGAACTCGAGTTCCTGTGGCGTAGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001658.3-425s21c1
Sequence:CCGGCAATGACAGAGAGCGTGTGAACTCGAGTTCACACGCTCTCTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001658.x-249s1c1
Sequence:CCGGCAAGAACATCAGCTTCACTGTCTCGAGACAGTGAAGCTGATGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.x-1182s1c1
Sequence:CCGGCAATTCTGCATGGTCACAGTACTCGAGTACTGTGACCATGCAGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-510s1c1
Sequence:CCGGGCACTCACTACGCCACAGGAACTCGAGTTCCTGTGGCGTAGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-1086s1c1
Sequence:CCGGCCTAGCATAGATTTGCAGTTACTCGAGTAACTGCAAATCTATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-162s1c1
Sequence:CCGGGAAGACCACGATCCTCTACAACTCGAGTTGTAGAGGATCGTGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-435s1c1
Sequence:CCGGCCTCCTGGTGTTCGCCAACAACTCGAGTTGTTGGCGAACACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-357s1c1
Sequence:CCGGCAATGACAGAGAGCGTGTGAACTCGAGTTCACACGCTCTCTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001658
VALIDATED
ARF1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001658.3-1156s21c1
Sequence:CCGGCCTAGCATAGATTTGCAGTTACTCGAGTAACTGCAAATCTATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001658.3-503s21c1
Sequence:CCGGCCTCCTGGTGTTCGCCAACAACTCGAGTTGTTGGCGAACACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001658.3-230s21c1
Sequence:CCGGGAAGACCACGATCCTCTACAACTCGAGTTGTAGAGGATCGTGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001658.3-578s21c1
Sequence:CCGGGCACTCACTACGCCACAGGAACTCGAGTTCCTGTGGCGTAGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001658.3-425s21c1
Sequence:CCGGCAATGACAGAGAGCGTGTGAACTCGAGTTCACACGCTCTCTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001658.x-249s1c1
Sequence:CCGGCAAGAACATCAGCTTCACTGTCTCGAGACAGTGAAGCTGATGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.x-1182s1c1
Sequence:CCGGCAATTCTGCATGGTCACAGTACTCGAGTACTGTGACCATGCAGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-510s1c1
Sequence:CCGGGCACTCACTACGCCACAGGAACTCGAGTTCCTGTGGCGTAGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-1086s1c1
Sequence:CCGGCCTAGCATAGATTTGCAGTTACTCGAGTAACTGCAAATCTATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-162s1c1
Sequence:CCGGGAAGACCACGATCCTCTACAACTCGAGTTGTAGAGGATCGTGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-435s1c1
Sequence:CCGGCCTCCTGGTGTTCGCCAACAACTCGAGTTGTTGGCGAACACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001658.2-357s1c1
Sequence:CCGGCAATGACAGAGAGCGTGTGAACTCGAGTTCACACGCTCTCTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks