EMAIL THIS PAGE TO A FRIEND

ARF3

ADP-ribosylation factor 3

UniProtKB ID: P61204, A8K6G8, P16587
Gene ID:
Human(377) Summary: ADP-ribosylation factor 3 (ARF3) is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The gene products include 6 ARF proteins and 11 ARF-like proteins and constitute 1 family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2,and ARF3), class II (ARF4 and ARF5) and class III (ARF6) and members of each class share a common gene organization. The ARF3 gene contains five exons and four introns. [provided by RefSeq, Jul 2008]
Mouse(11842) ADP-ribosylation factor 3
Rat(140940) ADP-ribosylation factor 3
Thale Cress(817014) ADP-ribosylation factor 3
dog(486562) ADP-ribosylation factor 3
cow(510994) ADP-ribosylation factor 3
domestic cat(101093367) ADP-ribosylation factor 3
domestic guinea pig(100729194) ADP-ribosylation factor 3
naked mole-rat(101722972) ADP-ribosylation factor 3
sheep(100302303) ADP-ribosylation factor 3
215 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001659 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160031 MISSION® esiRNA esiRNA human ARF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001659 Rosetta Predictions human pricing
NM_080904 Rosetta Predictions rat pricing
NM_007478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232072 predicted 406
2 SASI_Hs01_00232073 predicted 335
3 SASI_Hs01_00232074 predicted 526
4 SASI_Hs02_00332265 predicted 955
5 SASI_Hs01_00232075 predicted 963
6 SASI_Hs01_00232076 predicted 510
7 SASI_Hs01_00232077 predicted 983
8 SASI_Hs01_00232078 predicted 997
9 SASI_Hs01_00232079 predicted 987
10 SASI_Hs01_00232080 predicted 337
11 SASI_Hs01_00232081 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112334 predicted 1017
2 SASI_Rn01_00112335 predicted 221
3 SASI_Rn01_00112336 predicted 814
4 SASI_Rn01_00112337 predicted 813
5 SASI_Rn01_00112338 predicted 1081
6 SASI_Rn02_00267359 predicted 884
7 SASI_Rn01_00112339 predicted 327
8 SASI_Rn01_00112340 predicted 1009
9 SASI_Rn02_00267360 predicted 1074
10 SASI_Rn02_00267361 predicted 469
11 SASI_Rn01_00112333 predicted 1091
12 SASI_Rn01_00112341 predicted 920
13 SASI_Rn01_00112342 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164535 predicted 1185
2 SASI_Mm01_00164536 predicted 505
3 SASI_Mm01_00164537 predicted 604
4 SASI_Mm01_00164538 predicted 1185
5 SASI_Mm01_00164539 predicted 420
6 SASI_Mm01_00164540 predicted 1179
7 SASI_Mm01_00164541 predicted 323
8 SASI_Mm01_00164542 predicted 1191
9 SASI_Mm01_00164543 predicted 238
10 SASI_Mm01_00164544 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001659
VALIDATED
ARF3 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001659.2-801s21c1
Sequence:CCGGAGCCAGACAGCCCTAACAAAGCTCGAGCTTTGTTAGGGCTGTCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001659.2-649s21c1
Sequence:CCGGTGCTATGAACGCTGCTGAGATCTCGAGATCTCAGCAGCGTTCATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001659.2-535s21c1
Sequence:CCGGCAATGATCGGGAGCGAGTAAACTCGAGTTTACTCGCTCCCGATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001659.2-516s21c1
Sequence:CCGGTGATATTTGTGGTCGACAGCACTCGAGTGCTGTCGACCACAAATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001659.2-687s21c1
Sequence:CCGGTGCATTCCCTTCGTCACCGTACTCGAGTACGGTGACGAAGGGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001659.2-1002s21c1
Sequence:CCGGATGATGAGTCATTCCAATTTACTCGAGTAAATTGGAATGACTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001659.1-560s1c1
Sequence:CCGGGAACACCCAAGGGTTGATATTCTCGAGAATATCAACCCTTGGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001659.1-446s1c1
Sequence:CCGGCATCCCTACCATTGGGTTCAACTCGAGTTGAACCCAATGGTAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001659.1-663s1c1
Sequence:CCGGGATGCTGTACTCCTTGTCTTTCTCGAGAAAGACAAGGAGTACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001659.1-756s1c1
Sequence:CCGGCGTCACCGTAACTGGTACATTCTCGAGAATGTACCAGTTACGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001659.1-338s1c1
Sequence:CCGGCAAGAGCCTGATTGGGAAGAACTCGAGTTCTTCCCAATCAGGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001659
VALIDATED
ARF3 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001659.2-801s21c1
Sequence:CCGGAGCCAGACAGCCCTAACAAAGCTCGAGCTTTGTTAGGGCTGTCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001659.2-649s21c1
Sequence:CCGGTGCTATGAACGCTGCTGAGATCTCGAGATCTCAGCAGCGTTCATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001659.2-535s21c1
Sequence:CCGGCAATGATCGGGAGCGAGTAAACTCGAGTTTACTCGCTCCCGATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001659.2-516s21c1
Sequence:CCGGTGATATTTGTGGTCGACAGCACTCGAGTGCTGTCGACCACAAATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001659.2-687s21c1
Sequence:CCGGTGCATTCCCTTCGTCACCGTACTCGAGTACGGTGACGAAGGGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001659.2-1002s21c1
Sequence:CCGGATGATGAGTCATTCCAATTTACTCGAGTAAATTGGAATGACTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001659.1-560s1c1
Sequence:CCGGGAACACCCAAGGGTTGATATTCTCGAGAATATCAACCCTTGGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001659.1-446s1c1
Sequence:CCGGCATCCCTACCATTGGGTTCAACTCGAGTTGAACCCAATGGTAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001659.1-663s1c1
Sequence:CCGGGATGCTGTACTCCTTGTCTTTCTCGAGAAAGACAAGGAGTACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001659.1-756s1c1
Sequence:CCGGCGTCACCGTAACTGGTACATTCTCGAGAATGTACCAGTTACGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001659.1-338s1c1
Sequence:CCGGCAAGAGCCTGATTGGGAAGAACTCGAGTTCTTCCCAATCAGGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001659
VALIDATED
ARF3 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001659.2-801s21c1
Sequence:CCGGAGCCAGACAGCCCTAACAAAGCTCGAGCTTTGTTAGGGCTGTCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001659.2-649s21c1
Sequence:CCGGTGCTATGAACGCTGCTGAGATCTCGAGATCTCAGCAGCGTTCATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001659.2-535s21c1
Sequence:CCGGCAATGATCGGGAGCGAGTAAACTCGAGTTTACTCGCTCCCGATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001659.2-516s21c1
Sequence:CCGGTGATATTTGTGGTCGACAGCACTCGAGTGCTGTCGACCACAAATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001659.2-687s21c1
Sequence:CCGGTGCATTCCCTTCGTCACCGTACTCGAGTACGGTGACGAAGGGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001659.2-1002s21c1
Sequence:CCGGATGATGAGTCATTCCAATTTACTCGAGTAAATTGGAATGACTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001659.1-560s1c1
Sequence:CCGGGAACACCCAAGGGTTGATATTCTCGAGAATATCAACCCTTGGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001659.1-446s1c1
Sequence:CCGGCATCCCTACCATTGGGTTCAACTCGAGTTGAACCCAATGGTAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001659.1-663s1c1
Sequence:CCGGGATGCTGTACTCCTTGTCTTTCTCGAGAAAGACAAGGAGTACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001659.1-756s1c1
Sequence:CCGGCGTCACCGTAACTGGTACATTCTCGAGAATGTACCAGTTACGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001659.1-338s1c1
Sequence:CCGGCAAGAGCCTGATTGGGAAGAACTCGAGTTCTTCCCAATCAGGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007478
VALIDATED
ARF3 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-1863s21c1
Sequence:CCGGCCTCAGTATCAACTCCCTGTTCTCGAGAACAGGGAGTTGATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007478.3-588s21c1
Sequence:CCGGGCTCCTTGTGTTTGCAAACAACTCGAGTTGTTTGCAAACACAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-673s21c1
Sequence:CCGGCGTCACCGCAATTGGTACATTCTCGAGAATGTACCAATTGCGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-255s21c1
Sequence:CCGGGAAGAGCCTAATCGGCAAGAACTCGAGTTCTTGCCGATTAGGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-364s21c1
Sequence:GTACCGGATCCCGACCATTGGGTTTAATCTCGAGATTAAACCCAATGGTCGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-614s21c1
Sequence:GTACCGGATTTGCCGAATGCTATGAATGCTCGAGCATTCATAGCATTCGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007478.2-1863s1c1
Sequence:CCGGCCTCAGTATCAACTCCCTGTTCTCGAGAACAGGGAGTTGATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007478.2-588s1c1
Sequence:CCGGGCTCCTTGTGTTTGCAAACAACTCGAGTTGTTTGCAAACACAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007478.2-484s1c1
Sequence:CCGGCAAGGCTTGATATTTGTGGTTCTCGAGAACCACAAATATCAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007478.2-673s1c1
Sequence:CCGGCGTCACCGCAATTGGTACATTCTCGAGAATGTACCAATTGCGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007478.2-255s1c1
Sequence:CCGGGAAGAGCCTAATCGGCAAGAACTCGAGTTCTTGCCGATTAGGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007478
VALIDATED
ARF3 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-1863s21c1
Sequence:CCGGCCTCAGTATCAACTCCCTGTTCTCGAGAACAGGGAGTTGATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007478.3-588s21c1
Sequence:CCGGGCTCCTTGTGTTTGCAAACAACTCGAGTTGTTTGCAAACACAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-673s21c1
Sequence:CCGGCGTCACCGCAATTGGTACATTCTCGAGAATGTACCAATTGCGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-255s21c1
Sequence:CCGGGAAGAGCCTAATCGGCAAGAACTCGAGTTCTTGCCGATTAGGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-364s21c1
Sequence:GTACCGGATCCCGACCATTGGGTTTAATCTCGAGATTAAACCCAATGGTCGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-614s21c1
Sequence:GTACCGGATTTGCCGAATGCTATGAATGCTCGAGCATTCATAGCATTCGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007478.2-1863s1c1
Sequence:CCGGCCTCAGTATCAACTCCCTGTTCTCGAGAACAGGGAGTTGATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007478.2-588s1c1
Sequence:CCGGGCTCCTTGTGTTTGCAAACAACTCGAGTTGTTTGCAAACACAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007478.2-484s1c1
Sequence:CCGGCAAGGCTTGATATTTGTGGTTCTCGAGAACCACAAATATCAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007478.2-673s1c1
Sequence:CCGGCGTCACCGCAATTGGTACATTCTCGAGAATGTACCAATTGCGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007478.2-255s1c1
Sequence:CCGGGAAGAGCCTAATCGGCAAGAACTCGAGTTCTTGCCGATTAGGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007478
VALIDATED
ARF3 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-1863s21c1
Sequence:CCGGCCTCAGTATCAACTCCCTGTTCTCGAGAACAGGGAGTTGATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007478.3-588s21c1
Sequence:CCGGGCTCCTTGTGTTTGCAAACAACTCGAGTTGTTTGCAAACACAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-673s21c1
Sequence:CCGGCGTCACCGCAATTGGTACATTCTCGAGAATGTACCAATTGCGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-255s21c1
Sequence:CCGGGAAGAGCCTAATCGGCAAGAACTCGAGTTCTTGCCGATTAGGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-364s21c1
Sequence:GTACCGGATCCCGACCATTGGGTTTAATCTCGAGATTAAACCCAATGGTCGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007478.3-614s21c1
Sequence:GTACCGGATTTGCCGAATGCTATGAATGCTCGAGCATTCATAGCATTCGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007478.2-1863s1c1
Sequence:CCGGCCTCAGTATCAACTCCCTGTTCTCGAGAACAGGGAGTTGATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007478.2-588s1c1
Sequence:CCGGGCTCCTTGTGTTTGCAAACAACTCGAGTTGTTTGCAAACACAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007478.2-484s1c1
Sequence:CCGGCAAGGCTTGATATTTGTGGTTCTCGAGAACCACAAATATCAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007478.2-673s1c1
Sequence:CCGGCGTCACCGCAATTGGTACATTCTCGAGAATGTACCAATTGCGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007478.2-255s1c1
Sequence:CCGGGAAGAGCCTAATCGGCAAGAACTCGAGTTCTTGCCGATTAGGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks