EMAIL THIS PAGE TO A FRIEND

ARF4

ADP-ribosylation factor 4

108 Gene Product Result for
Synonyms: ARF2
UniProtKB ID: P18085, B2R7J7, P21371
Gene ID:
Human(378) Summary: This gene is a member of the human ARF gene family whose members encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The gene products include 5 ARF proteins and 11 ARF-like proteins and constitute one family of the RAS superfamily. The ARF proteins are categorized as class I, class II and class III; this gene is a class II member. The members of each class share a common gene organization. The ARF4 gene spans approximately 12kb and contains six exons and five introns. This gene is the most divergent member of the human ARFs. Conflicting map positions at 3p14 or 3p21 have been reported for this gene. [provided by RefSeq, Jul 2008]
Mouse(11843) ADP-ribosylation factor 4
Rat(79120) ADP-ribosylation factor 4
Thale Cress(836166) auxin response factor 4
cow(282601) ADP-ribosylation factor 4
cow(518601) ADP-ribosylation factor 4
domestic cat(101097876) ADP-ribosylation factor 4
dog(607073) ADP-ribosylation factor 4
chicken(769725) ADP-ribosylation factor 4
sheep(100302304) ADP-ribosylation factor 4
domestic guinea pig(100723892) ADP-ribosylation factor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001660 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001660 Rosetta Predictions human pricing
NM_024151 Rosetta Predictions rat pricing
NM_007479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235316 predicted 590
2 SASI_Hs01_00235317 predicted 538
3 SASI_Hs01_00235318 predicted 847
4 SASI_Hs01_00235319 predicted 436
5 SASI_Hs01_00235320 predicted 764
6 SASI_Hs01_00235321 predicted 721
7 SASI_Hs01_00235322 predicted 381
8 SASI_Hs01_00235323 predicted 425
9 SASI_Hs02_00332266 predicted 376
10 SASI_Hs02_00332267 predicted 876
11 SASI_Hs01_00235324 predicted 649
12 SASI_Hs01_00235325 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090888 predicted 835
2 SASI_Rn02_00263880 predicted 649
3 SASI_Rn01_00090889 predicted 634
4 SASI_Rn01_00090890 predicted 785
5 SASI_Rn01_00090891 predicted 823
6 SASI_Rn02_00263881 predicted 827
7 SASI_Rn01_00090892 predicted 459
8 SASI_Rn01_00090893 predicted 414
9 SASI_Rn01_00090894 predicted 632
10 SASI_Rn01_00090895 predicted 680
11 SASI_Rn01_00090887 predicted 504
12 SASI_Rn01_00090896 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130004 predicted 313
2 SASI_Mm01_00130005 predicted 738
3 SASI_Mm01_00130006 predicted 641
4 SASI_Mm01_00130007 predicted 712
5 SASI_Mm01_00130008 predicted 837
6 SASI_Mm01_00130009 predicted 786
7 SASI_Mm01_00130010 predicted 829
8 SASI_Mm01_00130012 predicted 466
9 SASI_Mm01_00130013 predicted 852
10 SASI_Mm02_00311742 predicted 293
11 SASI_Mm01_00130011 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001660
VALIDATED
ARF4 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor 4
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001660.2-614s1c1
Sequence:CCGGCCATCAGTGAAATGACAGATACTCGAGTATCTGTCATTTCACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001660.2-665s1c1
Sequence:CCGGCATGGTATGTTCAAGCCACTTCTCGAGAAGTGGCTTGAACATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001660.2-296s1c1
Sequence:CCGGGCAAGACAACCATTCTGTATACTCGAGTATACAGAATGGTTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001660.2-435s1c1
Sequence:CCGGGCCTCTCTGGAAGCATTACTTCTCGAGAAGTAATGCTTCCAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001660.3-1040s21c1
Sequence:GTACCGGCCGAGTATAATGTTGCTATTTCTCGAGAAATAGCAACATTATACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-573s21c1
Sequence:CCGGGCCTCTCTGGAAGCATTACTTCTCGAGAAGTAATGCTTCCAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-803s21c1
Sequence:CCGGCATGGTATGTTCAAGCCACTTCTCGAGAAGTGGCTTGAACATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-596s21c1
Sequence:CCGGAGAATACCCAGGGTCTTATTTCTCGAGAAATAAGACCCTGGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-1119s21c1
Sequence:CCGGTTACTTCCCATAAGCGTAAATCTCGAGATTTACGCTTATGGGAAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-752s21c1
Sequence:CCGGCCATCAGTGAAATGACAGATACTCGAGTATCTGTCATTTCACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001660.3-676s21c1
Sequence:GTACCGGATGCTTCTGGTAGATGAATTGCTCGAGCAATTCATCTACCAGAAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001660.3-1148s21c1
Sequence:GTACCGGATAGCTCTTGTGCAACCTTTACTCGAGTAAAGGTTGCACAAGAGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001660.3-437s21c1
Sequence:GTACCGGAGACAACCATTCTGTATAAACCTCGAGGTTTATACAGAATGGTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001660.3-624s21c1
Sequence:GTACCGGAGATAGCAACGATCGTGAAAGCTCGAGCTTTCACGATCGTTGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001660
VALIDATED
ARF4 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor 4
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001660.2-614s1c1
Sequence:CCGGCCATCAGTGAAATGACAGATACTCGAGTATCTGTCATTTCACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001660.2-665s1c1
Sequence:CCGGCATGGTATGTTCAAGCCACTTCTCGAGAAGTGGCTTGAACATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001660.2-296s1c1
Sequence:CCGGGCAAGACAACCATTCTGTATACTCGAGTATACAGAATGGTTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001660.2-435s1c1
Sequence:CCGGGCCTCTCTGGAAGCATTACTTCTCGAGAAGTAATGCTTCCAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001660.3-1040s21c1
Sequence:GTACCGGCCGAGTATAATGTTGCTATTTCTCGAGAAATAGCAACATTATACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-573s21c1
Sequence:CCGGGCCTCTCTGGAAGCATTACTTCTCGAGAAGTAATGCTTCCAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-803s21c1
Sequence:CCGGCATGGTATGTTCAAGCCACTTCTCGAGAAGTGGCTTGAACATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-596s21c1
Sequence:CCGGAGAATACCCAGGGTCTTATTTCTCGAGAAATAAGACCCTGGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-1119s21c1
Sequence:CCGGTTACTTCCCATAAGCGTAAATCTCGAGATTTACGCTTATGGGAAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-752s21c1
Sequence:CCGGCCATCAGTGAAATGACAGATACTCGAGTATCTGTCATTTCACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001660.3-676s21c1
Sequence:GTACCGGATGCTTCTGGTAGATGAATTGCTCGAGCAATTCATCTACCAGAAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001660.3-1148s21c1
Sequence:GTACCGGATAGCTCTTGTGCAACCTTTACTCGAGTAAAGGTTGCACAAGAGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001660.3-437s21c1
Sequence:GTACCGGAGACAACCATTCTGTATAAACCTCGAGGTTTATACAGAATGGTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001660.3-624s21c1
Sequence:GTACCGGAGATAGCAACGATCGTGAAAGCTCGAGCTTTCACGATCGTTGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001660
VALIDATED
ARF4 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor 4
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001660.2-614s1c1
Sequence:CCGGCCATCAGTGAAATGACAGATACTCGAGTATCTGTCATTTCACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001660.2-665s1c1
Sequence:CCGGCATGGTATGTTCAAGCCACTTCTCGAGAAGTGGCTTGAACATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001660.2-296s1c1
Sequence:CCGGGCAAGACAACCATTCTGTATACTCGAGTATACAGAATGGTTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001660.2-435s1c1
Sequence:CCGGGCCTCTCTGGAAGCATTACTTCTCGAGAAGTAATGCTTCCAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001660.3-1040s21c1
Sequence:GTACCGGCCGAGTATAATGTTGCTATTTCTCGAGAAATAGCAACATTATACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-573s21c1
Sequence:CCGGGCCTCTCTGGAAGCATTACTTCTCGAGAAGTAATGCTTCCAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-803s21c1
Sequence:CCGGCATGGTATGTTCAAGCCACTTCTCGAGAAGTGGCTTGAACATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-596s21c1
Sequence:CCGGAGAATACCCAGGGTCTTATTTCTCGAGAAATAAGACCCTGGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-1119s21c1
Sequence:CCGGTTACTTCCCATAAGCGTAAATCTCGAGATTTACGCTTATGGGAAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001660.3-752s21c1
Sequence:CCGGCCATCAGTGAAATGACAGATACTCGAGTATCTGTCATTTCACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001660.3-676s21c1
Sequence:GTACCGGATGCTTCTGGTAGATGAATTGCTCGAGCAATTCATCTACCAGAAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001660.3-1148s21c1
Sequence:GTACCGGATAGCTCTTGTGCAACCTTTACTCGAGTAAAGGTTGCACAAGAGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001660.3-437s21c1
Sequence:GTACCGGAGACAACCATTCTGTATAAACCTCGAGGTTTATACAGAATGGTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001660.3-624s21c1
Sequence:GTACCGGAGATAGCAACGATCGTGAAAGCTCGAGCTTTCACGATCGTTGCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007479
VALIDATED
ARF4 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007479.2-1478s1c1
Sequence:CCGGGCCCAGTATATGATAGTTCTACTCGAGTAGAACTATCATATACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007479.2-739s1c1
Sequence:CCGGGCTGTCAAATGAACTTTCAAACTCGAGTTTGAAAGTTCATTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007479.2-497s1c1
Sequence:CCGGGTAGATAGCAATGATCGTGAACTCGAGTTCACGATCATTGCTATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007479.2-664s1c1
Sequence:CCGGTCTCCGAAACAGAACATGGTACTCGAGTACCATGTTCTGTTTCGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007479.2-693s1c1
Sequence:CCGGCCACTTGTGCTACACAAGGAACTCGAGTTCCTTGTGTAGCACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007479.3-875s21c1
Sequence:GTACCGGGGCAGAAATTACAGCGTTTAACTCGAGTTAAACGCTGTAATTTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-761s21c1
Sequence:CCGGCGTTAAATGAAGCTGGATATCCTCGAGGATATCCAGCTTCATTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-422s21c1
Sequence:CCGGGATGTTGGTGGTCAAGATAAACTCGAGTTTATCTTGACCACCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-471s21c1
Sequence:CCGGAGAATACCCAGGGTCTCATTTCTCGAGAAATGAGACCCTGGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-1098s21c1
Sequence:CCGGAGTTATTCCCTTGATACTTTACTCGAGTAAAGTATCAAGGGAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-497s21c1
Sequence:CCGGGTAGATAGCAATGATCGTGAACTCGAGTTCACGATCATTGCTATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007479.3-1001s21c1
Sequence:GTACCGGTATGCTTCCCTTGAACCTAAACTCGAGTTTAGGTTCAAGGGAAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007479
VALIDATED
ARF4 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007479.2-1478s1c1
Sequence:CCGGGCCCAGTATATGATAGTTCTACTCGAGTAGAACTATCATATACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007479.2-739s1c1
Sequence:CCGGGCTGTCAAATGAACTTTCAAACTCGAGTTTGAAAGTTCATTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007479.2-497s1c1
Sequence:CCGGGTAGATAGCAATGATCGTGAACTCGAGTTCACGATCATTGCTATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007479.2-664s1c1
Sequence:CCGGTCTCCGAAACAGAACATGGTACTCGAGTACCATGTTCTGTTTCGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007479.2-693s1c1
Sequence:CCGGCCACTTGTGCTACACAAGGAACTCGAGTTCCTTGTGTAGCACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007479.3-875s21c1
Sequence:GTACCGGGGCAGAAATTACAGCGTTTAACTCGAGTTAAACGCTGTAATTTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-761s21c1
Sequence:CCGGCGTTAAATGAAGCTGGATATCCTCGAGGATATCCAGCTTCATTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-422s21c1
Sequence:CCGGGATGTTGGTGGTCAAGATAAACTCGAGTTTATCTTGACCACCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-471s21c1
Sequence:CCGGAGAATACCCAGGGTCTCATTTCTCGAGAAATGAGACCCTGGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-1098s21c1
Sequence:CCGGAGTTATTCCCTTGATACTTTACTCGAGTAAAGTATCAAGGGAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-497s21c1
Sequence:CCGGGTAGATAGCAATGATCGTGAACTCGAGTTCACGATCATTGCTATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007479.3-1001s21c1
Sequence:GTACCGGTATGCTTCCCTTGAACCTAAACTCGAGTTTAGGTTCAAGGGAAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007479
VALIDATED
ARF4 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007479.2-1478s1c1
Sequence:CCGGGCCCAGTATATGATAGTTCTACTCGAGTAGAACTATCATATACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007479.2-739s1c1
Sequence:CCGGGCTGTCAAATGAACTTTCAAACTCGAGTTTGAAAGTTCATTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007479.2-497s1c1
Sequence:CCGGGTAGATAGCAATGATCGTGAACTCGAGTTCACGATCATTGCTATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007479.2-664s1c1
Sequence:CCGGTCTCCGAAACAGAACATGGTACTCGAGTACCATGTTCTGTTTCGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007479.2-693s1c1
Sequence:CCGGCCACTTGTGCTACACAAGGAACTCGAGTTCCTTGTGTAGCACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007479.3-875s21c1
Sequence:GTACCGGGGCAGAAATTACAGCGTTTAACTCGAGTTAAACGCTGTAATTTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-761s21c1
Sequence:CCGGCGTTAAATGAAGCTGGATATCCTCGAGGATATCCAGCTTCATTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-422s21c1
Sequence:CCGGGATGTTGGTGGTCAAGATAAACTCGAGTTTATCTTGACCACCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-471s21c1
Sequence:CCGGAGAATACCCAGGGTCTCATTTCTCGAGAAATGAGACCCTGGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-1098s21c1
Sequence:CCGGAGTTATTCCCTTGATACTTTACTCGAGTAAAGTATCAAGGGAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007479.3-497s21c1
Sequence:CCGGGTAGATAGCAATGATCGTGAACTCGAGTTCACGATCATTGCTATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007479.3-1001s21c1
Sequence:GTACCGGTATGCTTCCCTTGAACCTAAACTCGAGTTTAGGTTCAAGGGAAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks