EMAIL THIS PAGE TO A FRIEND

ARF5

ADP-ribosylation factor 5

72 Gene Product Result for
UniProtKB ID: P84085, P26437
Gene ID:
Human(381) Summary: This gene is a member of the human ADP-ribosylation factor (ARF) gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The gene products include 6 ARF proteins and 11 ARF-like proteins and constitute 1 family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2,and ARF3), class II (ARF4 and ARF5) and class III (ARF6). The members of each class share a common gene organization. [provided by RefSeq, Dec 2010]
Mouse(11844) ADP-ribosylation factor 5
Rat(79117) ADP-ribosylation factor 5
Zebrafish(378724) ADP-ribosylation factor 5
chicken(396265) ADP-ribosylation factor 5
cow(511918) ADP-ribosylation factor 5
dog(475206) ADP-ribosylation factor 5
domestic guinea pig(100726135) ADP-ribosylation factor 5
naked mole-rat(101725842) ADP-ribosylation factor 5
sheep(100302305) ADP-ribosylation factor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001662 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127151 MISSION® esiRNA esiRNA human ARF5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001662 Rosetta Predictions human pricing
NM_024149 Rosetta Predictions rat pricing
NM_007480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332272 predicted 292
2 SASI_Hs02_00332273 predicted 382
3 SASI_Hs02_00332274 predicted 289
4 SASI_Hs01_00024787 predicted 394
5 SASI_Hs01_00024788 predicted 378
6 SASI_Hs01_00024789 predicted 256
7 SASI_Hs01_00024790 predicted 487
8 SASI_Hs01_00024791 predicted 280
9 SASI_Hs01_00024793 predicted 520
10 SASI_Hs01_00024794 predicted 261
11 SASI_Hs01_00024792 predicted 632
12 SASI_Hs01_00024795 predicted 331
13 SASI_Hs01_00024796 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072406 predicted 578
2 SASI_Rn01_00072407 predicted 388
3 SASI_Rn01_00072408 predicted 310
4 SASI_Rn01_00072409 predicted 312
5 SASI_Rn01_00072410 predicted 342
6 SASI_Rn01_00072411 predicted 311
7 SASI_Rn01_00072412 predicted 351
8 SASI_Rn01_00072413 predicted 310
9 SASI_Rn01_00072414 predicted 583
10 SASI_Rn02_00263878 predicted 495
11 SASI_Rn01_00072415 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050303 predicted 301
2 SASI_Mm01_00050304 predicted 461
3 SASI_Mm01_00050305 predicted 269
4 SASI_Mm01_00050306 predicted 354
5 SASI_Mm01_00050307 predicted 350
6 SASI_Mm01_00050308 predicted 310
7 SASI_Mm01_00050309 predicted 640
8 SASI_Mm01_00050310 predicted 274
9 SASI_Mm01_00050311 predicted 569
10 SASI_Mm01_00050312 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007480
VALIDATED
ARF5 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-730s21c1
Sequence:GTACCGGGCATGCTCTCTCTTGTCGTTGCTCGAGCAACGACAAGAGAGAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-358s21c1
Sequence:GTACCGGTGCTGATGAACTCCAGAAGATCTCGAGATCTTCTGGAGTTCATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-94s21c1
Sequence:GTACCGGGAAGCAGATGCGGATCCTTATCTCGAGATAAGGATCCGCATCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-566s21c1
Sequence:GTACCGGCTGTCCCACGAGCTGTCAAAGCTCGAGCTTTGACAGCTCGTGGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-225s21c1
Sequence:GTACCGGAGAACATCTGTTTCACAGTGTCTCGAGACACTGTGAAACAGATGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-133s1c1
Sequence:CCGGTGGCAAGACTACCATCCTGTACTCGAGTACAGGATGGTAGTCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-103s1c1
Sequence:CCGGGCGGATCCTTATGGTTGGCTTCTCGAGAAGCCAACCATAAGGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-202s1c1
Sequence:CCGGCAATGTGGAAACAGTGGAATACTCGAGTATTCCACTGTTTCCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-344s1c1
Sequence:CCGGCGGGTCCAGGAGTCTGCTGATCTCGAGATCAGCAGACTCCTGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-571s1c1
Sequence:CCGGCCACGAGCTGTCAAAGCGCTACTCGAGTAGCGCTTTGACAGCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007480
VALIDATED
ARF5 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-730s21c1
Sequence:GTACCGGGCATGCTCTCTCTTGTCGTTGCTCGAGCAACGACAAGAGAGAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-358s21c1
Sequence:GTACCGGTGCTGATGAACTCCAGAAGATCTCGAGATCTTCTGGAGTTCATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-94s21c1
Sequence:GTACCGGGAAGCAGATGCGGATCCTTATCTCGAGATAAGGATCCGCATCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-566s21c1
Sequence:GTACCGGCTGTCCCACGAGCTGTCAAAGCTCGAGCTTTGACAGCTCGTGGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-225s21c1
Sequence:GTACCGGAGAACATCTGTTTCACAGTGTCTCGAGACACTGTGAAACAGATGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-133s1c1
Sequence:CCGGTGGCAAGACTACCATCCTGTACTCGAGTACAGGATGGTAGTCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-103s1c1
Sequence:CCGGGCGGATCCTTATGGTTGGCTTCTCGAGAAGCCAACCATAAGGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-202s1c1
Sequence:CCGGCAATGTGGAAACAGTGGAATACTCGAGTATTCCACTGTTTCCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-344s1c1
Sequence:CCGGCGGGTCCAGGAGTCTGCTGATCTCGAGATCAGCAGACTCCTGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-571s1c1
Sequence:CCGGCCACGAGCTGTCAAAGCGCTACTCGAGTAGCGCTTTGACAGCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007480
VALIDATED
ARF5 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-730s21c1
Sequence:GTACCGGGCATGCTCTCTCTTGTCGTTGCTCGAGCAACGACAAGAGAGAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-358s21c1
Sequence:GTACCGGTGCTGATGAACTCCAGAAGATCTCGAGATCTTCTGGAGTTCATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-94s21c1
Sequence:GTACCGGGAAGCAGATGCGGATCCTTATCTCGAGATAAGGATCCGCATCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-566s21c1
Sequence:GTACCGGCTGTCCCACGAGCTGTCAAAGCTCGAGCTTTGACAGCTCGTGGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007480.1-225s21c1
Sequence:GTACCGGAGAACATCTGTTTCACAGTGTCTCGAGACACTGTGAAACAGATGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-133s1c1
Sequence:CCGGTGGCAAGACTACCATCCTGTACTCGAGTACAGGATGGTAGTCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-103s1c1
Sequence:CCGGGCGGATCCTTATGGTTGGCTTCTCGAGAAGCCAACCATAAGGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-202s1c1
Sequence:CCGGCAATGTGGAAACAGTGGAATACTCGAGTATTCCACTGTTTCCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-344s1c1
Sequence:CCGGCGGGTCCAGGAGTCTGCTGATCTCGAGATCAGCAGACTCCTGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007480.1-571s1c1
Sequence:CCGGCCACGAGCTGTCAAAGCGCTACTCGAGTAGCGCTTTGACAGCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001662
VALIDATED
ARF5 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001662.2-659s21c1
Sequence:GTACCGGAGTGCCCTTTCCTCCCACTTTCTCGAGAAAGTGGGAGGAAAGGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001662.2-648s21c1
Sequence:GTACCGGACTCCTCAGGCAGTGCCCTTTCTCGAGAAAGGGCACTGCCTGAGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001662.2-334s21c1
Sequence:CCGGGTCCAAGAATCTGCTGATGAACTCGAGTTCATCAGCAGATTCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001662.2-388s21c1
Sequence:CCGGGATGCAGTGCTGCTGGTATTTCTCGAGAAATACCAGCAGCACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001662.2-85s21c1
Sequence:CCGGCAGATGCGGATTCTCATGGTTCTCGAGAACCATGAGAATCCGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001662.2-125s21c1
Sequence:CCGGAGACCACAATCCTGTACAAACCTCGAGGTTTGTACAGGATTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001662.2-720s21c1
Sequence:CCGGTGCATGTTCTCTCTGTTGTTGCTCGAGCAACAACAGAGAGAACATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-396s1c1
Sequence:CCGGGCTGCTGGTATTTGCCAACAACTCGAGTTGTTGGCAAATACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-334s1c1
Sequence:CCGGGTCCAAGAATCTGCTGATGAACTCGAGTTCATCAGCAGATTCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-388s1c1
Sequence:CCGGGATGCAGTGCTGCTGGTATTTCTCGAGAAATACCAGCAGCACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-85s1c1
Sequence:CCGGCAGATGCGGATTCTCATGGTTCTCGAGAACCATGAGAATCCGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-175s1c1
Sequence:CCGGCCAACCATAGGCTTCAATGTACTCGAGTACATTGAAGCCTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001662
VALIDATED
ARF5 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001662.2-659s21c1
Sequence:GTACCGGAGTGCCCTTTCCTCCCACTTTCTCGAGAAAGTGGGAGGAAAGGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001662.2-648s21c1
Sequence:GTACCGGACTCCTCAGGCAGTGCCCTTTCTCGAGAAAGGGCACTGCCTGAGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001662.2-334s21c1
Sequence:CCGGGTCCAAGAATCTGCTGATGAACTCGAGTTCATCAGCAGATTCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001662.2-388s21c1
Sequence:CCGGGATGCAGTGCTGCTGGTATTTCTCGAGAAATACCAGCAGCACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001662.2-85s21c1
Sequence:CCGGCAGATGCGGATTCTCATGGTTCTCGAGAACCATGAGAATCCGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001662.2-125s21c1
Sequence:CCGGAGACCACAATCCTGTACAAACCTCGAGGTTTGTACAGGATTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001662.2-720s21c1
Sequence:CCGGTGCATGTTCTCTCTGTTGTTGCTCGAGCAACAACAGAGAGAACATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-396s1c1
Sequence:CCGGGCTGCTGGTATTTGCCAACAACTCGAGTTGTTGGCAAATACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-334s1c1
Sequence:CCGGGTCCAAGAATCTGCTGATGAACTCGAGTTCATCAGCAGATTCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-388s1c1
Sequence:CCGGGATGCAGTGCTGCTGGTATTTCTCGAGAAATACCAGCAGCACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-85s1c1
Sequence:CCGGCAGATGCGGATTCTCATGGTTCTCGAGAACCATGAGAATCCGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-175s1c1
Sequence:CCGGCCAACCATAGGCTTCAATGTACTCGAGTACATTGAAGCCTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001662
VALIDATED
ARF5 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001662.2-659s21c1
Sequence:GTACCGGAGTGCCCTTTCCTCCCACTTTCTCGAGAAAGTGGGAGGAAAGGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001662.2-648s21c1
Sequence:GTACCGGACTCCTCAGGCAGTGCCCTTTCTCGAGAAAGGGCACTGCCTGAGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001662.2-334s21c1
Sequence:CCGGGTCCAAGAATCTGCTGATGAACTCGAGTTCATCAGCAGATTCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001662.2-388s21c1
Sequence:CCGGGATGCAGTGCTGCTGGTATTTCTCGAGAAATACCAGCAGCACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001662.2-85s21c1
Sequence:CCGGCAGATGCGGATTCTCATGGTTCTCGAGAACCATGAGAATCCGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001662.2-125s21c1
Sequence:CCGGAGACCACAATCCTGTACAAACCTCGAGGTTTGTACAGGATTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001662.2-720s21c1
Sequence:CCGGTGCATGTTCTCTCTGTTGTTGCTCGAGCAACAACAGAGAGAACATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-396s1c1
Sequence:CCGGGCTGCTGGTATTTGCCAACAACTCGAGTTGTTGGCAAATACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-334s1c1
Sequence:CCGGGTCCAAGAATCTGCTGATGAACTCGAGTTCATCAGCAGATTCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-388s1c1
Sequence:CCGGGATGCAGTGCTGCTGGTATTTCTCGAGAAATACCAGCAGCACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-85s1c1
Sequence:CCGGCAGATGCGGATTCTCATGGTTCTCGAGAACCATGAGAATCCGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001662.2-175s1c1
Sequence:CCGGCCAACCATAGGCTTCAATGTACTCGAGTACATTGAAGCCTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks