EMAIL THIS PAGE TO A FRIEND

ARF6

ADP-ribosylation factor 6

100 Gene Product Result for
UniProtKB ID: P62330, P26438, Q6FGZ2
Gene ID:
Human(382) Summary: This gene encodes a member of the human ARF gene family, which is part of the RAS superfamily. The ARF genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The product of this gene is localized to the plasma membrane, and regulates vesicular trafficking, remodelling of membrane lipids, and signaling pathways that lead to actin remodeling. A pseudogene of this gene is located on chromosome 7. [provided by RefSeq, Jul 2008]
Mouse(11845) ADP-ribosylation factor 6
Rat(79121) ADP-ribosylation factor 6
Thale Cress(839913) auxin response factor 6
chicken(428927) ADP-ribosylation factor 6
cow(614161) ADP-ribosylation factor 6
cow(100294979) ADP-ribosylation factor 6
domestic cat(101093695) ADP-ribosylation factor 6
dog(490679) ADP-ribosylation factor 6
sheep(100302306) ADP-ribosylation factor 6
naked mole-rat(101703058) ADP-ribosylation factor 6
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV54598 Anti-ARF6 antibody produced in rabbit affinity isolated antibody zebrafish, rabbit, mouse, rat, guinea pig, horse, canine, human, sheep,
western blot pricing
SAB3501102 Anti-ARF6 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
A5230 Anti-ARF6 antibody, Mouse monoclonal clone ARFAG, purified from hybridoma cell culture canine, bovine, rat, human
western blot pricing
WH0000382M1 Monoclonal Anti-ARF6 antibody produced in mouse clone 2A4, ascites fluid, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001663 Rosetta Predictions human pricing
NM_024152 Rosetta Predictions rat pricing
NM_007481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185059 predicted 949
2 SASI_Hs02_00332275 predicted 1460
3 SASI_Hs02_00332276 predicted 1374
4 SASI_Hs02_00332277 predicted 1263
5 SASI_Hs02_00332278 predicted 1403
6 SASI_Hs02_00332279 predicted 1464
7 SASI_Hs02_00332280 predicted 1130
8 SASI_Hs02_00332281 predicted 1122
9 SASI_Hs02_00332282 predicted 1466
10 SASI_Hs02_00332283 predicted 1129
11 SASI_Hs01_00185058 predicted 761
12 SASI_Hs01_00185060 predicted 641
13 SASI_Hs01_00185061 predicted 690
14 SASI_Hs01_00185062 predicted 757
15 SASI_Hs01_00185063 predicted 641
16 SASI_Hs01_00185064 predicted 856
17 SASI_Hs01_00185065 predicted 659
18 SASI_Hs01_00185066 predicted 661
19 SASI_Hs01_00185067 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108964 predicted 226
2 SASI_Rn01_00108965 predicted 656
3 SASI_Rn01_00108966 predicted 734
4 SASI_Rn01_00108968 predicted 743
5 SASI_Rn02_00263882 predicted 481
6 SASI_Rn01_00108969 predicted 478
7 SASI_Rn01_00108970 predicted 259
8 SASI_Rn01_00108971 predicted 272
9 SASI_Rn01_00108972 predicted 639
10 SASI_Rn01_00108973 predicted 657
11 SASI_Rn01_00108967 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099795 predicted 623
2 SASI_Mm02_00311743 predicted 1489
3 SASI_Mm02_00311744 predicted 1493
4 SASI_Mm02_00311745 predicted 1484
5 SASI_Mm02_00311746 predicted 1526
6 SASI_Mm02_00311747 predicted 1476
7 SASI_Mm01_00099798 predicted 564
8 SASI_Mm02_00311748 predicted 1341
9 SASI_Mm01_00099800 predicted 674
10 SASI_Mm02_00311749 predicted 1272
11 SASI_Mm01_00099794 predicted 755
12 SASI_Mm01_00099796 predicted 578
13 SASI_Mm01_00099797 predicted 834
14 SASI_Mm01_00099799 predicted 833
15 SASI_Mm01_00099801 predicted 610
16 SASI_Mm01_00099802 predicted 757
17 SASI_Mm01_00099803 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001663
VALIDATED
ARF6 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor 6
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001663.2-686s1c1
Sequence:CCGGGTCAAGTTCAACGTATGGGATCTCGAGATCCCATACGTTGAACTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001663.2-1012s1c1
Sequence:CCGGGCTCACATGGTTAACCTCTAACTCGAGTTAGAGGTTAACCATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001663.2-743s1c1
Sequence:CCGGCATTACTACACTGGGACCCAACTCGAGTTGGGTCCCAGTGTAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001663.2-544s1c1
Sequence:CCGGCGGGAACAAGGAAATGCGGATCTCGAGATCCGCATTTCCTTGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001663.2-831s1c1
Sequence:CCGGGCATTATCAATGACCGGGAGACTCGAGTCTCCCGGTCATTGATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-761s21c1
Sequence:GTACCGGTCAACGTGGAGACGGTGACTTCTCGAGAAGTCACCGTCTCCACGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001663.3-744s21c1
Sequence:GTACCGGCATTCCCACTGTGGGTTTCAACTCGAGTTGAAACCCACAGTGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-968s21c1
Sequence:GTACCGGTAATCCTCATCTTCGCCAACACTCGAGTGTTGGCGAAGATGAGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-938s21c1
Sequence:GTACCGGTTATCAATGACCGGGAGATGACTCGAGTCATCTCCCGGTCATTGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001663.3-839s21c1
Sequence:GTACCGGTCTGGCGGCATTACTACACTGCTCGAGCAGTGTAGTAATGCCGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001663.3-657s21c1
Sequence:GTACCGGGGAAATGCGGATCCTCATGTTCTCGAGAACATGAGGATCCGCATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-792s21c1
Sequence:GTACCGGCAAGTTCAACGTATGGGATGTCTCGAGACATCCCATACGTTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1116s21c1
Sequence:CCGGGCTCACATGGTTAACCTCTAACTCGAGTTAGAGGTTAACCATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1570s21c1
Sequence:CCGGCTTGCTGTAGATGGCTTATTTCTCGAGAAATAAGCCATCTACAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-701s21c1
Sequence:CCGGCAACAATCCTGTACAAGTTGACTCGAGTCAACTTGTACAGGATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1053s21c1
Sequence:CCGGTCGGGACAGGAACTGGTATGTCTCGAGACATACCAGTTCCTGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1376s21c1
Sequence:GTACCGGGGATGCTCTGATCTGACATTTCTCGAGAAATGTCAGATCAGAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1129s21c1
Sequence:GTACCGGACCTCTAACTACAAATCTTAACTCGAGTTAAGATTTGTAGTTAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-926s21c1
Sequence:GTACCGGAGCTGCACCGCATTATCAATGCTCGAGCATTGATAATGCGGTGCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001663
VALIDATED
ARF6 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor 6
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001663.2-686s1c1
Sequence:CCGGGTCAAGTTCAACGTATGGGATCTCGAGATCCCATACGTTGAACTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001663.2-1012s1c1
Sequence:CCGGGCTCACATGGTTAACCTCTAACTCGAGTTAGAGGTTAACCATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001663.2-743s1c1
Sequence:CCGGCATTACTACACTGGGACCCAACTCGAGTTGGGTCCCAGTGTAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001663.2-544s1c1
Sequence:CCGGCGGGAACAAGGAAATGCGGATCTCGAGATCCGCATTTCCTTGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001663.2-831s1c1
Sequence:CCGGGCATTATCAATGACCGGGAGACTCGAGTCTCCCGGTCATTGATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-761s21c1
Sequence:GTACCGGTCAACGTGGAGACGGTGACTTCTCGAGAAGTCACCGTCTCCACGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001663.3-744s21c1
Sequence:GTACCGGCATTCCCACTGTGGGTTTCAACTCGAGTTGAAACCCACAGTGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-968s21c1
Sequence:GTACCGGTAATCCTCATCTTCGCCAACACTCGAGTGTTGGCGAAGATGAGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-938s21c1
Sequence:GTACCGGTTATCAATGACCGGGAGATGACTCGAGTCATCTCCCGGTCATTGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001663.3-839s21c1
Sequence:GTACCGGTCTGGCGGCATTACTACACTGCTCGAGCAGTGTAGTAATGCCGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001663.3-657s21c1
Sequence:GTACCGGGGAAATGCGGATCCTCATGTTCTCGAGAACATGAGGATCCGCATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-792s21c1
Sequence:GTACCGGCAAGTTCAACGTATGGGATGTCTCGAGACATCCCATACGTTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1116s21c1
Sequence:CCGGGCTCACATGGTTAACCTCTAACTCGAGTTAGAGGTTAACCATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1570s21c1
Sequence:CCGGCTTGCTGTAGATGGCTTATTTCTCGAGAAATAAGCCATCTACAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-701s21c1
Sequence:CCGGCAACAATCCTGTACAAGTTGACTCGAGTCAACTTGTACAGGATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1053s21c1
Sequence:CCGGTCGGGACAGGAACTGGTATGTCTCGAGACATACCAGTTCCTGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1376s21c1
Sequence:GTACCGGGGATGCTCTGATCTGACATTTCTCGAGAAATGTCAGATCAGAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1129s21c1
Sequence:GTACCGGACCTCTAACTACAAATCTTAACTCGAGTTAAGATTTGTAGTTAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-926s21c1
Sequence:GTACCGGAGCTGCACCGCATTATCAATGCTCGAGCATTGATAATGCGGTGCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001663
VALIDATED
ARF6 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor 6
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001663.2-686s1c1
Sequence:CCGGGTCAAGTTCAACGTATGGGATCTCGAGATCCCATACGTTGAACTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001663.2-1012s1c1
Sequence:CCGGGCTCACATGGTTAACCTCTAACTCGAGTTAGAGGTTAACCATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001663.2-743s1c1
Sequence:CCGGCATTACTACACTGGGACCCAACTCGAGTTGGGTCCCAGTGTAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001663.2-544s1c1
Sequence:CCGGCGGGAACAAGGAAATGCGGATCTCGAGATCCGCATTTCCTTGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001663.2-831s1c1
Sequence:CCGGGCATTATCAATGACCGGGAGACTCGAGTCTCCCGGTCATTGATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-761s21c1
Sequence:GTACCGGTCAACGTGGAGACGGTGACTTCTCGAGAAGTCACCGTCTCCACGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001663.3-744s21c1
Sequence:GTACCGGCATTCCCACTGTGGGTTTCAACTCGAGTTGAAACCCACAGTGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-968s21c1
Sequence:GTACCGGTAATCCTCATCTTCGCCAACACTCGAGTGTTGGCGAAGATGAGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-938s21c1
Sequence:GTACCGGTTATCAATGACCGGGAGATGACTCGAGTCATCTCCCGGTCATTGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001663.3-839s21c1
Sequence:GTACCGGTCTGGCGGCATTACTACACTGCTCGAGCAGTGTAGTAATGCCGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001663.3-657s21c1
Sequence:GTACCGGGGAAATGCGGATCCTCATGTTCTCGAGAACATGAGGATCCGCATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-792s21c1
Sequence:GTACCGGCAAGTTCAACGTATGGGATGTCTCGAGACATCCCATACGTTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1116s21c1
Sequence:CCGGGCTCACATGGTTAACCTCTAACTCGAGTTAGAGGTTAACCATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1570s21c1
Sequence:CCGGCTTGCTGTAGATGGCTTATTTCTCGAGAAATAAGCCATCTACAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-701s21c1
Sequence:CCGGCAACAATCCTGTACAAGTTGACTCGAGTCAACTTGTACAGGATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1053s21c1
Sequence:CCGGTCGGGACAGGAACTGGTATGTCTCGAGACATACCAGTTCCTGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1376s21c1
Sequence:GTACCGGGGATGCTCTGATCTGACATTTCTCGAGAAATGTCAGATCAGAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-1129s21c1
Sequence:GTACCGGACCTCTAACTACAAATCTTAACTCGAGTTAAGATTTGTAGTTAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001663.3-926s21c1
Sequence:GTACCGGAGCTGCACCGCATTATCAATGCTCGAGCATTGATAATGCGGTGCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007481
VALIDATED
ARF6 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor 6
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007481.2-1056s1c1
Sequence:CCGGCCGGAAGGAGAGAAATCCAAACTCGAGTTTGGATTTCTCTCCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007481.2-578s1c1
Sequence:CCGGCGGCAAGACAACGATCCTGTACTCGAGTACAGGATCGTTGTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007481.2-597s1c1
Sequence:CCGGTACAAGTTGAAGCTGGGCCAACTCGAGTTGGCCCAGCTTCAACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007481.2-731s1c1
Sequence:CCGGGCATTACTACACCGGGACCCACTCGAGTGGGTCCCGGTGTAGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007481.2-647s1c1
Sequence:CCGGCAACGTGGAGACGGTGACTTACTCGAGTAAGTCACCGTCTCCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007481.3-1280s21c1
Sequence:CCGGATCTGACATTTGACACGAATACTCGAGTATTCGTGTCAAATGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-1047s21c1
Sequence:CCGGGGTTAACCTCTAACTACAAATCTCGAGATTTGTAGTTAGAGGTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-849s21c1
Sequence:CCGGAGCTGCACCGCATTATCAATGCTCGAGCATTGATAATGCGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-975s21c1
Sequence:CCGGTTCGGGACAGGAACTGGTATGCTCGAGCATACCAGTTCCTGTCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-769s21c1
Sequence:CCGGGCATTACTACACCGGGACCCACTCGAGTGGGTCCCGGTGTAGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-883s21c1
Sequence:GTACCGGGGACGCCATCATCCTCATCTTCTCGAGAAGATGAGGATGATGGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-624s21c1
Sequence:GTACCGGCAACGATCCTGTACAAGTTGACTCGAGTCAACTTGTACAGGATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007481
VALIDATED
ARF6 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor 6
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007481.2-1056s1c1
Sequence:CCGGCCGGAAGGAGAGAAATCCAAACTCGAGTTTGGATTTCTCTCCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007481.2-578s1c1
Sequence:CCGGCGGCAAGACAACGATCCTGTACTCGAGTACAGGATCGTTGTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007481.2-597s1c1
Sequence:CCGGTACAAGTTGAAGCTGGGCCAACTCGAGTTGGCCCAGCTTCAACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007481.2-731s1c1
Sequence:CCGGGCATTACTACACCGGGACCCACTCGAGTGGGTCCCGGTGTAGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007481.2-647s1c1
Sequence:CCGGCAACGTGGAGACGGTGACTTACTCGAGTAAGTCACCGTCTCCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007481.3-1280s21c1
Sequence:CCGGATCTGACATTTGACACGAATACTCGAGTATTCGTGTCAAATGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-1047s21c1
Sequence:CCGGGGTTAACCTCTAACTACAAATCTCGAGATTTGTAGTTAGAGGTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-849s21c1
Sequence:CCGGAGCTGCACCGCATTATCAATGCTCGAGCATTGATAATGCGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-975s21c1
Sequence:CCGGTTCGGGACAGGAACTGGTATGCTCGAGCATACCAGTTCCTGTCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-769s21c1
Sequence:CCGGGCATTACTACACCGGGACCCACTCGAGTGGGTCCCGGTGTAGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-883s21c1
Sequence:GTACCGGGGACGCCATCATCCTCATCTTCTCGAGAAGATGAGGATGATGGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-624s21c1
Sequence:GTACCGGCAACGATCCTGTACAAGTTGACTCGAGTCAACTTGTACAGGATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007481
VALIDATED
ARF6 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor 6
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007481.2-1056s1c1
Sequence:CCGGCCGGAAGGAGAGAAATCCAAACTCGAGTTTGGATTTCTCTCCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007481.2-578s1c1
Sequence:CCGGCGGCAAGACAACGATCCTGTACTCGAGTACAGGATCGTTGTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007481.2-597s1c1
Sequence:CCGGTACAAGTTGAAGCTGGGCCAACTCGAGTTGGCCCAGCTTCAACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007481.2-731s1c1
Sequence:CCGGGCATTACTACACCGGGACCCACTCGAGTGGGTCCCGGTGTAGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007481.2-647s1c1
Sequence:CCGGCAACGTGGAGACGGTGACTTACTCGAGTAAGTCACCGTCTCCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007481.3-1280s21c1
Sequence:CCGGATCTGACATTTGACACGAATACTCGAGTATTCGTGTCAAATGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-1047s21c1
Sequence:CCGGGGTTAACCTCTAACTACAAATCTCGAGATTTGTAGTTAGAGGTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-849s21c1
Sequence:CCGGAGCTGCACCGCATTATCAATGCTCGAGCATTGATAATGCGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-975s21c1
Sequence:CCGGTTCGGGACAGGAACTGGTATGCTCGAGCATACCAGTTCCTGTCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-769s21c1
Sequence:CCGGGCATTACTACACCGGGACCCACTCGAGTGGGTCCCGGTGTAGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-883s21c1
Sequence:GTACCGGGGACGCCATCATCCTCATCTTCTCGAGAAGATGAGGATGATGGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007481.3-624s21c1
Sequence:GTACCGGCAACGATCCTGTACAAGTTGACTCGAGTCAACTTGTACAGGATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks