EMAIL THIS PAGE TO A FRIEND

ARFGAP1

ADP-ribosylation factor GTPase activating protein 1

Synonyms: ARF1GAP HRIHFB2281
Gene ID:
Human(55738) Summary: The protein encoded by this gene is a GTPase-activating protein (GAP) which associates with the Golgi apparatus and which interacts with ADP-ribosylation factor 1 (ARF1). The encoded protein promotes hydrolysis of ARF1-bound GTP and is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is required for the fusion of these vesicles with target compartments. The activity of this protein is stimulated by phosphoinosides and inhibited by phosphatidylcholine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(228998) ADP-ribosylation factor GTPase activating protein 1
Rat(246310) ADP-ribosylation factor GTPase activating protein 1
Zebrafish(100149572) ADP-ribosylation factor GTPase activating protein 1
cow(506471) ADP-ribosylation factor GTPase activating protein 1
domestic cat(101096717) ADP-ribosylation factor GTPase activating protein 1
dog(612498) ADP-ribosylation factor GTPase activating protein 1
chicken(419241) ADP-ribosylation factor GTPase activating protein 1
domestic guinea pig(100733002) ADP-ribosylation factor GTPase activating protein 1
naked mole-rat(101712809) ADP-ribosylation factor GTPase activating protein 1
sheep(101110163) ADP-ribosylation factor GTPase activating protein 1
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175609 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075611 MISSION® esiRNA esiRNA human ARF1GAP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018209 Rosetta Predictions human pricing
NM_175609 Rosetta Predictions human pricing
NM_145090 Rosetta Predictions rat pricing
NM_145760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149820 predicted 1778
2 SASI_Hs01_00149821 predicted 443
3 SASI_Hs01_00149822 predicted 316
4 SASI_Hs01_00149823 predicted 1423
5 SASI_Hs02_00351514 predicted 1726
6 SASI_Hs01_00149824 predicted 546
7 SASI_Hs01_00149825 predicted 371
8 SASI_Hs01_00149826 predicted 339
9 SASI_Hs01_00149827 predicted 1660
10 SASI_Hs01_00149828 predicted 1172
11 SASI_Hs01_00149829 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079619 predicted 1804
2 SASI_Hs01_00079620 predicted 444
3 SASI_Hs01_00079621 predicted 309
4 SASI_Hs01_00079622 predicted 1449
5 SASI_Hs02_00369009 predicted 1744
6 SASI_Hs01_00079623 predicted 545
7 SASI_Hs01_00079624 predicted 367
8 SASI_Hs01_00079625 predicted 343
9 SASI_Hs01_00079626 predicted 1679
10 SASI_Hs01_00079627 predicted 1198
11 SASI_Hs01_00079628 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268684 predicted 952
2 SASI_Rn01_00085036 predicted 1193
3 SASI_Rn01_00085038 predicted 1599
4 SASI_Rn01_00085039 predicted 329
5 SASI_Rn01_00085040 predicted 877
6 SASI_Rn01_00085042 predicted 624
7 SASI_Rn01_00085043 predicted 610
8 SASI_Rn02_00268685 predicted 1585
9 SASI_Rn01_00085044 predicted 1237
10 SASI_Rn01_00085045 predicted 500
11 SASI_Rn01_00085037 predicted 1062
12 SASI_Rn01_00085041 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046547 predicted 1590
2 SASI_Mm01_00046548 predicted 1190
3 SASI_Mm01_00046549 predicted 447
4 SASI_Mm02_00341281 predicted 1486
5 SASI_Mm01_00046550 predicted 623
6 SASI_Mm01_00046551 predicted 817
7 SASI_Mm01_00046553 predicted 606
8 SASI_Mm01_00046554 predicted 354
9 SASI_Mm01_00046555 predicted 1097
10 SASI_Mm01_00046556 predicted 982
11 SASI_Mm01_00046552 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145760
VALIDATED
ARFGAP1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor GTPase activating protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145760.2-950s21c1
Sequence:CCGGAGCAAAGGAGGGTGCTACAAACTCGAGTTTGTAGCACCCTCCTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145760.2-1882s21c1
Sequence:CCGGGAAAGTGCCTGGAGCCTTAAACTCGAGTTTAAGGCTCCAGGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145760.2-624s21c1
Sequence:CCGGGCTACTTTGGCAGAAGGTAAACTCGAGTTTACCTTCTGCCAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145760.2-2038s1c1
Sequence:CCGGGCCCTCAGTTAAATGGGACAACTCGAGTTGTCCCATTTAACTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145760.2-1139s1c1
Sequence:CCGGGCGTGATGTCACTACTTTCTTCTCGAGAAGAAAGTAGTGACATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145760.2-810s1c1
Sequence:CCGGGCTCAGGAGAATCGCTATGTACTCGAGTACATAGCGATTCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145760.2-321s1c1
Sequence:CCGGGCACAGGATGAGAATAATGTTCTCGAGAACATTATTCTCATCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145760.2-455s1c1
Sequence:CCGGGCGCTCTGTTACAATGGACAACTCGAGTTGTCCATTGTAACAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145760
VALIDATED
ARFGAP1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor GTPase activating protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145760.2-950s21c1
Sequence:CCGGAGCAAAGGAGGGTGCTACAAACTCGAGTTTGTAGCACCCTCCTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145760.2-1882s21c1
Sequence:CCGGGAAAGTGCCTGGAGCCTTAAACTCGAGTTTAAGGCTCCAGGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145760.2-624s21c1
Sequence:CCGGGCTACTTTGGCAGAAGGTAAACTCGAGTTTACCTTCTGCCAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145760.2-2038s1c1
Sequence:CCGGGCCCTCAGTTAAATGGGACAACTCGAGTTGTCCCATTTAACTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145760.2-1139s1c1
Sequence:CCGGGCGTGATGTCACTACTTTCTTCTCGAGAAGAAAGTAGTGACATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145760.2-810s1c1
Sequence:CCGGGCTCAGGAGAATCGCTATGTACTCGAGTACATAGCGATTCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145760.2-321s1c1
Sequence:CCGGGCACAGGATGAGAATAATGTTCTCGAGAACATTATTCTCATCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145760.2-455s1c1
Sequence:CCGGGCGCTCTGTTACAATGGACAACTCGAGTTGTCCATTGTAACAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145760
VALIDATED
ARFGAP1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor GTPase activating protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145760.2-950s21c1
Sequence:CCGGAGCAAAGGAGGGTGCTACAAACTCGAGTTTGTAGCACCCTCCTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145760.2-1882s21c1
Sequence:CCGGGAAAGTGCCTGGAGCCTTAAACTCGAGTTTAAGGCTCCAGGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145760.2-624s21c1
Sequence:CCGGGCTACTTTGGCAGAAGGTAAACTCGAGTTTACCTTCTGCCAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145760.2-2038s1c1
Sequence:CCGGGCCCTCAGTTAAATGGGACAACTCGAGTTGTCCCATTTAACTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145760.2-1139s1c1
Sequence:CCGGGCGTGATGTCACTACTTTCTTCTCGAGAAGAAAGTAGTGACATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145760.2-810s1c1
Sequence:CCGGGCTCAGGAGAATCGCTATGTACTCGAGTACATAGCGATTCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145760.2-321s1c1
Sequence:CCGGGCACAGGATGAGAATAATGTTCTCGAGAACATTATTCTCATCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145760.2-455s1c1
Sequence:CCGGGCGCTCTGTTACAATGGACAACTCGAGTTGTCCATTGTAACAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175609
VALIDATED
ARFGAP1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor GTPase activating protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175609.1-289s21c1
Sequence:CCGGGCGCTCTGTTACTATGGACAACTCGAGTTGTCCATAGTAACAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_175609.1-683s21c1
Sequence:CCGGCCGCCTCAGAAGAAAGAAGATCTCGAGATCTTCTTTCTTCTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_175609.1-1684s21c1
Sequence:CCGGGCCAGTTCACTACGCAGTATCCTCGAGGATACTGCGTAGTGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175609.1-155s21c1
Sequence:CCGGGTGCAGGATGAGAACAACGTTCTCGAGAACGTTGTTCTCATCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175609.1-683s1c1
Sequence:CCGGCCGCCTCAGAAGAAAGAAGATCTCGAGATCTTCTTTCTTCTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175609.1-797s1c1
Sequence:CCGGGCTACAAAGTTTGGATCCCAACTCGAGTTGGGATCCAAACTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_175609.1-349s1c1
Sequence:CCGGGAATGCTAAGTTCCGAGAGTTCTCGAGAACTCTCGGAACTTAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175609.1-289s1c1
Sequence:CCGGGCGCTCTGTTACTATGGACAACTCGAGTTGTCCATAGTAACAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_175609.1-155s1c1
Sequence:CCGGGTGCAGGATGAGAACAACGTTCTCGAGAACGTTGTTCTCATCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175609
VALIDATED
ARFGAP1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor GTPase activating protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175609.1-289s21c1
Sequence:CCGGGCGCTCTGTTACTATGGACAACTCGAGTTGTCCATAGTAACAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_175609.1-683s21c1
Sequence:CCGGCCGCCTCAGAAGAAAGAAGATCTCGAGATCTTCTTTCTTCTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_175609.1-1684s21c1
Sequence:CCGGGCCAGTTCACTACGCAGTATCCTCGAGGATACTGCGTAGTGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175609.1-155s21c1
Sequence:CCGGGTGCAGGATGAGAACAACGTTCTCGAGAACGTTGTTCTCATCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175609.1-683s1c1
Sequence:CCGGCCGCCTCAGAAGAAAGAAGATCTCGAGATCTTCTTTCTTCTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175609.1-797s1c1
Sequence:CCGGGCTACAAAGTTTGGATCCCAACTCGAGTTGGGATCCAAACTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_175609.1-349s1c1
Sequence:CCGGGAATGCTAAGTTCCGAGAGTTCTCGAGAACTCTCGGAACTTAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175609.1-289s1c1
Sequence:CCGGGCGCTCTGTTACTATGGACAACTCGAGTTGTCCATAGTAACAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_175609.1-155s1c1
Sequence:CCGGGTGCAGGATGAGAACAACGTTCTCGAGAACGTTGTTCTCATCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175609
VALIDATED
ARFGAP1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor GTPase activating protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175609.1-289s21c1
Sequence:CCGGGCGCTCTGTTACTATGGACAACTCGAGTTGTCCATAGTAACAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_175609.1-683s21c1
Sequence:CCGGCCGCCTCAGAAGAAAGAAGATCTCGAGATCTTCTTTCTTCTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_175609.1-1684s21c1
Sequence:CCGGGCCAGTTCACTACGCAGTATCCTCGAGGATACTGCGTAGTGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175609.1-155s21c1
Sequence:CCGGGTGCAGGATGAGAACAACGTTCTCGAGAACGTTGTTCTCATCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175609.1-683s1c1
Sequence:CCGGCCGCCTCAGAAGAAAGAAGATCTCGAGATCTTCTTTCTTCTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175609.1-797s1c1
Sequence:CCGGGCTACAAAGTTTGGATCCCAACTCGAGTTGGGATCCAAACTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_175609.1-349s1c1
Sequence:CCGGGAATGCTAAGTTCCGAGAGTTCTCGAGAACTCTCGGAACTTAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175609.1-289s1c1
Sequence:CCGGGCGCTCTGTTACTATGGACAACTCGAGTTGTCCATAGTAACAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_175609.1-155s1c1
Sequence:CCGGGTGCAGGATGAGAACAACGTTCTCGAGAACGTTGTTCTCATCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks