EMAIL THIS PAGE TO A FRIEND

ARFGAP3

ADP-ribosylation factor GTPase activating protein 3

122 Gene Product Result for
Synonyms: ARFGAP1
Gene ID:
Human(26286) Summary: The protein encoded by this gene is a GTPase-activating protein (GAP) that associates with the Golgi apparatus and regulates the early secretory pathway of proteins. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1 (ARF1)-bound GTP, which is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is a prerequisite for the fusion of these vesicles with target compartments. The activity of this protein is sensitive to phospholipids. Multiple transcript variants encoding different isoforms have been found for this gene. This gene was originally known as ARFGAP1, but that is now the name of a related but different gene. [provided by RefSeq, Nov 2008]
Mouse(66251) ADP-ribosylation factor GTPase activating protein 3
Rat(503165) ADP-ribosylation factor GTPase activating protein 3
Zebrafish(402889) ADP-ribosylation factor GTPase activating protein 3
fruit fly(40487) ADP-ribosylation factor GTPase activating protein 3
cow(532778) ADP-ribosylation factor GTPase activating protein 3
chicken(418224) ADP-ribosylation factor GTPase activating protein 3
domestic cat(101091637) ADP-ribosylation factor GTPase activating protein 3
dog(474477) ADP-ribosylation factor GTPase activating protein 3
domestic guinea pig(100725575) ADP-ribosylation factor GTPase activating protein 3
naked mole-rat(101717408) ADP-ribosylation factor GTPase activating protein 3
sheep(101115447) ADP-ribosylation factor GTPase activating protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014570 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014570 Rosetta Predictions human pricing
NM_001044273 Rosetta Predictions rat pricing
XM_578689 Rosetta Predictions rat pricing
NM_025445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061661 predicted 1327
2 SASI_Hs01_00061662 predicted 1684
3 SASI_Hs01_00061663 predicted 1375
4 SASI_Hs01_00061664 predicted 1720
5 SASI_Hs01_00061666 predicted 1289
6 SASI_Hs02_00345836 predicted 1261
7 SASI_Hs01_00061667 predicted 313
8 SASI_Hs01_00061668 predicted 501
9 SASI_Hs01_00061669 predicted 224
10 SASI_Hs01_00061670 predicted 1463
11 SASI_Hs01_00061665 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205404 predicted 1446
2 SASI_Rn02_00205405 predicted 1376
3 SASI_Rn02_00205406 predicted 1796
4 SASI_Rn02_00205407 predicted 298
5 SASI_Rn02_00205408 predicted 296
6 SASI_Rn02_00205409 predicted 1387
7 SASI_Rn02_00205410 predicted 1170
8 SASI_Rn02_00205411 predicted 1388
9 SASI_Rn02_00205412 predicted 1357
10 SASI_Rn02_00205413 predicted 1839
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188190 predicted 262
2 SASI_Rn01_00188191 predicted 229
3 SASI_Rn01_00188192 predicted 221
4 SASI_Rn01_00188193 predicted 267
5 SASI_Rn01_00188194 predicted 225
6 SASI_Rn01_00188195 predicted 202
7 SASI_Rn01_00188196 predicted 201
8 SASI_Rn01_00188197 predicted 260
9 SASI_Rn01_00188198 predicted 229
10 SASI_Rn01_00188199 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123222 predicted 1413
2 SASI_Mm01_00123223 predicted 215
3 SASI_Mm01_00123224 predicted 1479
4 SASI_Mm02_00328273 predicted 1970
5 SASI_Mm01_00123225 predicted 1748
6 SASI_Mm01_00123226 predicted 1527
7 SASI_Mm02_00328274 predicted 1560
8 SASI_Mm01_00123228 predicted 1641
9 SASI_Mm02_00328275 predicted 229
10 SASI_Mm02_00328276 predicted 1536
11 SASI_Mm01_00123227 predicted 1975
12 SASI_Mm01_00123229 predicted 429
13 SASI_Mm01_00123230 predicted 1791
14 SASI_Mm01_00123231 predicted 1401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014570
VALIDATED
ARFGAP3 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor GTPase activating protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014570.4-1004s21c1
Sequence:CCGGGCCAAGGTGGTATCTAAAGAACTCGAGTTCTTTAGATACCACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014570.4-1436s21c1
Sequence:CCGGCCAGATTATGAGCCAGTTGAACTCGAGTTCAACTGGCTCATAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014570.4-1329s21c1
Sequence:CCGGGCTGGGATGACAGTTCAGATTCTCGAGAATCTGAACTGTCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014570.4-606s21c1
Sequence:CCGGGCACTGATCTGTGGCTTGATACTCGAGTATCAAGCCACAGATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014570.3-169s1c1
Sequence:CCGGGCCCACTAACAAGGTGTGTTTCTCGAGAAACACACCTTGTTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014570.3-1328s1c1
Sequence:CCGGCCAGATTATGAGCCAGTTGAACTCGAGTTCAACTGGCTCATAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014570.3-498s1c1
Sequence:CCGGGCACTGATCTGTGGCTTGATACTCGAGTATCAAGCCACAGATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014570.3-896s1c1
Sequence:CCGGGCCAAGGTGGTATCTAAAGAACTCGAGTTCTTTAGATACCACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014570.3-1221s1c1
Sequence:CCGGGCTGGGATGACAGTTCAGATTCTCGAGAATCTGAACTGTCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014570
VALIDATED
ARFGAP3 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor GTPase activating protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014570.4-1004s21c1
Sequence:CCGGGCCAAGGTGGTATCTAAAGAACTCGAGTTCTTTAGATACCACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014570.4-1436s21c1
Sequence:CCGGCCAGATTATGAGCCAGTTGAACTCGAGTTCAACTGGCTCATAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014570.4-1329s21c1
Sequence:CCGGGCTGGGATGACAGTTCAGATTCTCGAGAATCTGAACTGTCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014570.4-606s21c1
Sequence:CCGGGCACTGATCTGTGGCTTGATACTCGAGTATCAAGCCACAGATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014570.3-169s1c1
Sequence:CCGGGCCCACTAACAAGGTGTGTTTCTCGAGAAACACACCTTGTTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014570.3-1328s1c1
Sequence:CCGGCCAGATTATGAGCCAGTTGAACTCGAGTTCAACTGGCTCATAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014570.3-498s1c1
Sequence:CCGGGCACTGATCTGTGGCTTGATACTCGAGTATCAAGCCACAGATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014570.3-896s1c1
Sequence:CCGGGCCAAGGTGGTATCTAAAGAACTCGAGTTCTTTAGATACCACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014570.3-1221s1c1
Sequence:CCGGGCTGGGATGACAGTTCAGATTCTCGAGAATCTGAACTGTCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014570
VALIDATED
ARFGAP3 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor GTPase activating protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014570.4-1004s21c1
Sequence:CCGGGCCAAGGTGGTATCTAAAGAACTCGAGTTCTTTAGATACCACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014570.4-1436s21c1
Sequence:CCGGCCAGATTATGAGCCAGTTGAACTCGAGTTCAACTGGCTCATAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014570.4-1329s21c1
Sequence:CCGGGCTGGGATGACAGTTCAGATTCTCGAGAATCTGAACTGTCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014570.4-606s21c1
Sequence:CCGGGCACTGATCTGTGGCTTGATACTCGAGTATCAAGCCACAGATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014570.3-169s1c1
Sequence:CCGGGCCCACTAACAAGGTGTGTTTCTCGAGAAACACACCTTGTTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014570.3-1328s1c1
Sequence:CCGGCCAGATTATGAGCCAGTTGAACTCGAGTTCAACTGGCTCATAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014570.3-498s1c1
Sequence:CCGGGCACTGATCTGTGGCTTGATACTCGAGTATCAAGCCACAGATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014570.3-896s1c1
Sequence:CCGGGCCAAGGTGGTATCTAAAGAACTCGAGTTCTTTAGATACCACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014570.3-1221s1c1
Sequence:CCGGGCTGGGATGACAGTTCAGATTCTCGAGAATCTGAACTGTCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025445
ARFGAP3 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor GTPase activating protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025445.2-2094s1c1
Sequence:CCGGCCCACACAACACACACTTAAACTCGAGTTTAAGTGTGTGTTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025445.2-1245s1c1
Sequence:CCGGTGCCGATTCCTACTGGAAGAACTCGAGTTCTTCCAGTAGGAATCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025445.2-895s1c1
Sequence:CCGGCCAAAGGAGGAGTCTATTGTTCTCGAGAACAATAGACTCCTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025445.2-721s1c1
Sequence:CCGGCCAGAGGTTTCATCGATTATACTCGAGTATAATCGATGAAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025445.2-1246s1c1
Sequence:CCGGGCCGATTCCTACTGGAAGAAACTCGAGTTTCTTCCAGTAGGAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025445
ARFGAP3 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor GTPase activating protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025445.2-2094s1c1
Sequence:CCGGCCCACACAACACACACTTAAACTCGAGTTTAAGTGTGTGTTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025445.2-1245s1c1
Sequence:CCGGTGCCGATTCCTACTGGAAGAACTCGAGTTCTTCCAGTAGGAATCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025445.2-895s1c1
Sequence:CCGGCCAAAGGAGGAGTCTATTGTTCTCGAGAACAATAGACTCCTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025445.2-721s1c1
Sequence:CCGGCCAGAGGTTTCATCGATTATACTCGAGTATAATCGATGAAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025445.2-1246s1c1
Sequence:CCGGGCCGATTCCTACTGGAAGAAACTCGAGTTTCTTCCAGTAGGAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025445
ARFGAP3 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor GTPase activating protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025445.2-2094s1c1
Sequence:CCGGCCCACACAACACACACTTAAACTCGAGTTTAAGTGTGTGTTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025445.2-1245s1c1
Sequence:CCGGTGCCGATTCCTACTGGAAGAACTCGAGTTCTTCCAGTAGGAATCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025445.2-895s1c1
Sequence:CCGGCCAAAGGAGGAGTCTATTGTTCTCGAGAACAATAGACTCCTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025445.2-721s1c1
Sequence:CCGGCCAGAGGTTTCATCGATTATACTCGAGTATAATCGATGAAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025445.2-1246s1c1
Sequence:CCGGGCCGATTCCTACTGGAAGAAACTCGAGTTTCTTCCAGTAGGAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks