EMAIL THIS PAGE TO A FRIEND

ARFGEF1

ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)

178 Gene Product Result for
Synonyms: ARFGEP1 BIG1 P200
UniProtKB ID: Q9Y6D6, Q9NV46, Q9UFV2, Q9UNL0
Gene ID:
Human(10565) Summary: ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP. It contains a Sec7 domain, which may be responsible for guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Aug 2011]
Mouse(211673) ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)
Rat(312915) ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)
sheep(101102247) ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
naked mole-rat(101698432) ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
domestic guinea pig(100714174) ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
Zebrafish(100329953) ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)
chicken(420170) ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)
cow(281022) ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
Horse(100063272) ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
domestic cat(101092584) ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
dog(477903) ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006421 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001102430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001102430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001102430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006421 Rosetta Predictions human pricing
XM_001066125 Rosetta Predictions rat pricing
XM_232614 Rosetta Predictions rat pricing
NM_001102430 Rosetta Predictions mouse pricing
XM_001473166 Rosetta Predictions mouse pricing
XM_975420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119855 predicted 1517
2 SASI_Hs01_00119856 predicted 5278
3 SASI_Hs01_00119858 predicted 4453
4 SASI_Hs02_00341538 predicted 737
5 SASI_Hs01_00119859 predicted 5356
6 SASI_Hs01_00119860 predicted 3937
7 SASI_Hs01_00119862 predicted 5758
8 SASI_Hs01_00119863 predicted 2615
9 SASI_Hs02_00341539 predicted 615
10 SASI_Hs01_00119864 predicted 4408
11 SASI_Hs01_00119857 predicted 3219
12 SASI_Hs01_00119861 predicted 2254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316352 predicted 4908
2 SASI_Rn02_00316353 predicted 4069
3 SASI_Rn02_00316354 predicted 3494
4 SASI_Rn02_00316355 predicted 5688
5 SASI_Rn02_00316356 predicted 5351
6 SASI_Rn02_00316357 predicted 5278
7 SASI_Rn02_00316358 predicted 4371
8 SASI_Rn02_00316359 predicted 5359
9 SASI_Rn02_00316360 predicted 1748
10 SASI_Rn02_00316361 predicted 3925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232614 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387180 predicted 4910
2 SASI_Rn02_00387181 predicted 4064
3 SASI_Rn02_00387182 predicted 3495
4 SASI_Rn02_00387183 predicted 5684
5 SASI_Rn02_00387184 predicted 5349
6 SASI_Rn02_00387185 predicted 5276
7 SASI_Rn02_00387186 predicted 4366
8 SASI_Rn02_00387187 predicted 5361
9 SASI_Rn02_00387188 predicted 1741
10 SASI_Rn02_00387189 predicted 3922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302803 predicted 1793
2 SASI_Mm02_00302804 predicted 3352
3 SASI_Mm02_00302805 predicted 767
4 SASI_Mm02_00302806 predicted 1602
5 SASI_Mm02_00302807 predicted 1325
6 SASI_Mm02_00302808 predicted 4432
7 SASI_Mm02_00302809 predicted 460
8 SASI_Mm02_00302810 predicted 1727
9 SASI_Mm02_00302811 predicted 3101
10 SASI_Mm02_00302812 predicted 5197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00366416 predicted 1787
2 SASI_Mm02_00366417 predicted 3351
3 SASI_Mm02_00366418 predicted 771
4 SASI_Mm02_00366419 predicted 1603
5 SASI_Mm02_00366420 predicted 1325
6 SASI_Mm02_00366421 predicted 4436
7 SASI_Mm02_00366422 predicted 458
8 SASI_Mm02_00366423 predicted 1721
9 SASI_Mm02_00366424 predicted 3100
10 SASI_Mm02_00366425 predicted 5198
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277269 predicted 1989
2 SASI_Mm01_00277270 predicted 5697
3 SASI_Mm01_00277271 predicted 3549
4 SASI_Mm01_00277272 predicted 973
5 SASI_Mm01_00277273 predicted 1800
6 SASI_Mm01_00277274 predicted 4633
7 SASI_Mm01_00277275 predicted 656
8 SASI_Mm01_00277276 predicted 3296
9 SASI_Mm01_00277277 predicted 5406
10 SASI_Mm01_00277278 predicted 5749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006421
VALIDATED
ARFGEF1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006421.2-4462s1c1
Sequence:CCGGCCAGAACAACAGACAGAGAAACTCGAGTTTCTCTGTCTGTTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006421.2-5467s1c1
Sequence:CCGGGCCTGGACTAACTTACTGCTTCTCGAGAAGCAGTAAGTTAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006421.2-5553s1c1
Sequence:CCGGCCCTCTCTTATGTGAAATTATCTCGAGATAATTTCACATAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006421.2-817s1c1
Sequence:CCGGCGGCAGCATCATCATCTGTTACTCGAGTAACAGATGATGATGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006421.2-3403s1c1
Sequence:CCGGCCTGATGAATTTGTGGGTTTACTCGAGTAAACCCACAAATTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006421.3-5716s21c1
Sequence:CCGGGCCTGGACTAACTTACTGCTTCTCGAGAAGCAGTAAGTTAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006421.3-4711s21c1
Sequence:CCGGCCAGAACAACAGACAGAGAAACTCGAGTTTCTCTGTCTGTTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006421.3-3652s21c1
Sequence:CCGGCCTGATGAATTTGTGGGTTTACTCGAGTAAACCCACAAATTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006421.3-5802s21c1
Sequence:CCGGCCCTCTCTTATGTGAAATTATCTCGAGATAATTTCACATAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006421.3-1066s21c1
Sequence:CCGGCGGCAGCATCATCATCTGTTACTCGAGTAACAGATGATGATGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006421
VALIDATED
ARFGEF1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006421.2-4462s1c1
Sequence:CCGGCCAGAACAACAGACAGAGAAACTCGAGTTTCTCTGTCTGTTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006421.2-5467s1c1
Sequence:CCGGGCCTGGACTAACTTACTGCTTCTCGAGAAGCAGTAAGTTAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006421.2-5553s1c1
Sequence:CCGGCCCTCTCTTATGTGAAATTATCTCGAGATAATTTCACATAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006421.2-817s1c1
Sequence:CCGGCGGCAGCATCATCATCTGTTACTCGAGTAACAGATGATGATGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006421.2-3403s1c1
Sequence:CCGGCCTGATGAATTTGTGGGTTTACTCGAGTAAACCCACAAATTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006421.3-5716s21c1
Sequence:CCGGGCCTGGACTAACTTACTGCTTCTCGAGAAGCAGTAAGTTAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006421.3-4711s21c1
Sequence:CCGGCCAGAACAACAGACAGAGAAACTCGAGTTTCTCTGTCTGTTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006421.3-3652s21c1
Sequence:CCGGCCTGATGAATTTGTGGGTTTACTCGAGTAAACCCACAAATTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006421.3-5802s21c1
Sequence:CCGGCCCTCTCTTATGTGAAATTATCTCGAGATAATTTCACATAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006421.3-1066s21c1
Sequence:CCGGCGGCAGCATCATCATCTGTTACTCGAGTAACAGATGATGATGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006421
VALIDATED
ARFGEF1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006421.2-4462s1c1
Sequence:CCGGCCAGAACAACAGACAGAGAAACTCGAGTTTCTCTGTCTGTTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006421.2-5467s1c1
Sequence:CCGGGCCTGGACTAACTTACTGCTTCTCGAGAAGCAGTAAGTTAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006421.2-5553s1c1
Sequence:CCGGCCCTCTCTTATGTGAAATTATCTCGAGATAATTTCACATAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006421.2-817s1c1
Sequence:CCGGCGGCAGCATCATCATCTGTTACTCGAGTAACAGATGATGATGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006421.2-3403s1c1
Sequence:CCGGCCTGATGAATTTGTGGGTTTACTCGAGTAAACCCACAAATTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006421.3-5716s21c1
Sequence:CCGGGCCTGGACTAACTTACTGCTTCTCGAGAAGCAGTAAGTTAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006421.3-4711s21c1
Sequence:CCGGCCAGAACAACAGACAGAGAAACTCGAGTTTCTCTGTCTGTTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006421.3-3652s21c1
Sequence:CCGGCCTGATGAATTTGTGGGTTTACTCGAGTAAACCCACAAATTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006421.3-5802s21c1
Sequence:CCGGCCCTCTCTTATGTGAAATTATCTCGAGATAATTTCACATAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006421.3-1066s21c1
Sequence:CCGGCGGCAGCATCATCATCTGTTACTCGAGTAACAGATGATGATGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102430
VALIDATED
ARFGEF1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001102430.1-2995s21c1
Sequence:CCGGAGCACGTGAGGCCGATGTTTACTCGAGTAAACATCGGCCTCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001102430.1-2499s21c1
Sequence:CCGGGTTTCAGCTCTTCGTCTATTTCTCGAGAAATAGACGAAGAGCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001102430.1-3927s21c1
Sequence:CCGGGATATGGTTGTACGGTGTATACTCGAGTATACACCGTACAACCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001102430.1-2841s21c1
Sequence:CCGGATCCCTACAAAGTCAACTAAACTCGAGTTTAGTTGACTTTGTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102430.1-6326s21c1
Sequence:CCGGACTTGCTAAATACCCATAATACTCGAGTATTATGGGTATTTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102430
VALIDATED
ARFGEF1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001102430.1-2995s21c1
Sequence:CCGGAGCACGTGAGGCCGATGTTTACTCGAGTAAACATCGGCCTCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001102430.1-2499s21c1
Sequence:CCGGGTTTCAGCTCTTCGTCTATTTCTCGAGAAATAGACGAAGAGCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001102430.1-3927s21c1
Sequence:CCGGGATATGGTTGTACGGTGTATACTCGAGTATACACCGTACAACCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001102430.1-2841s21c1
Sequence:CCGGATCCCTACAAAGTCAACTAAACTCGAGTTTAGTTGACTTTGTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102430.1-6326s21c1
Sequence:CCGGACTTGCTAAATACCCATAATACTCGAGTATTATGGGTATTTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102430
VALIDATED
ARFGEF1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001102430.1-2995s21c1
Sequence:CCGGAGCACGTGAGGCCGATGTTTACTCGAGTAAACATCGGCCTCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001102430.1-2499s21c1
Sequence:CCGGGTTTCAGCTCTTCGTCTATTTCTCGAGAAATAGACGAAGAGCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001102430.1-3927s21c1
Sequence:CCGGGATATGGTTGTACGGTGTATACTCGAGTATACACCGTACAACCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001102430.1-2841s21c1
Sequence:CCGGATCCCTACAAAGTCAACTAAACTCGAGTTTAGTTGACTTTGTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102430.1-6326s21c1
Sequence:CCGGACTTGCTAAATACCCATAATACTCGAGTATTATGGGTATTTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks