EMAIL THIS PAGE TO A FRIEND

ARFGEF2

ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)

83 Gene Product Result for
Synonyms: BIG2 PVNH2 dJ1164I10.1
UniProtKB ID: Q9Y6D5, Q5TFT9, Q9NTS1
Gene ID:
Human(10564) Summary: ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP and is involved in Golgi transport. It contains a Sec7 domain, which may be responsible for its guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Jul 2008]
Mouse(99371) ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
Rat(296380) ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
Zebrafish(100334572) ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
cow(539295) ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
Horse(100071351) ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
domestic cat(101082556) ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
dog(477256) ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
chicken(419211) ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
domestic guinea pig(100724838) ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
naked mole-rat(101706311) ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
sheep(101116164) ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006420 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006420 Rosetta Predictions human pricing
NM_181083 Rosetta Predictions rat pricing
NM_001085495 Rosetta Predictions mouse pricing
XM_130646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120633 predicted 707
2 SASI_Hs02_00341534 predicted 3554
3 SASI_Hs01_00120634 predicted 892
4 SASI_Hs01_00120636 predicted 3936
5 SASI_Hs01_00120638 predicted 1705
6 SASI_Hs01_00120640 predicted 5030
7 SASI_Hs02_00341535 predicted 2330
8 SASI_Hs01_00120641 predicted 509
9 SASI_Hs02_00341536 predicted 1048
10 SASI_Hs02_00341537 predicted 4437
11 SASI_Hs01_00120632 predicted 2019
12 SASI_Hs01_00120635 predicted 682
13 SASI_Hs01_00120637 predicted 471
14 SASI_Hs01_00120639 predicted 2338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119066 predicted 2255
2 SASI_Rn01_00119067 predicted 5299
3 SASI_Rn01_00119069 predicted 4238
4 SASI_Rn01_00119070 predicted 5283
5 SASI_Rn01_00119071 predicted 4134
6 SASI_Rn02_00269663 predicted 2491
7 SASI_Rn02_00269664 predicted 1513
8 SASI_Rn02_00269665 predicted 279
9 SASI_Rn01_00119073 predicted 3537
10 SASI_Rn01_00119074 predicted 3359
11 SASI_Rn01_00119068 predicted 2734
12 SASI_Rn01_00119072 predicted 4231
13 SASI_Rn01_00119075 predicted 4357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300542 predicted 2786
2 SASI_Mm02_00300543 predicted 485
3 SASI_Mm02_00300544 predicted 3492
4 SASI_Mm02_00300545 predicted 4394
5 SASI_Mm02_00300546 predicted 4180
6 SASI_Mm02_00300547 predicted 2616
7 SASI_Mm02_00300548 predicted 5415
8 SASI_Mm02_00300549 predicted 3666
9 SASI_Mm02_00300550 predicted 4356
10 SASI_Mm02_00300551 predicted 2414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276963 predicted 2813
2 SASI_Mm01_00276964 predicted 511
3 SASI_Mm01_00276965 predicted 3510
4 SASI_Mm01_00276966 predicted 4421
5 SASI_Mm01_00276967 predicted 4202
6 SASI_Mm01_00276968 predicted 2640
7 SASI_Mm01_00276969 predicted 5436
8 SASI_Mm01_00276970 predicted 3684
9 SASI_Mm01_00276971 predicted 4374
10 SASI_Mm01_00276972 predicted 2444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085495
VALIDATED
ARFGEF2 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085495.2-1685s21c1
Sequence:CCGGCCAGTGCGTTGTGGATATTTACTCGAGTAAATATCCACAACGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085495.2-320s21c1
Sequence:CCGGCATTGAAGCTGACAAGTATTTCTCGAGAAATACTTGTCAGCTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085495.2-6793s21c1
Sequence:CCGGTACATCGAGTCCTACGAATTGCTCGAGCAATTCGTAGGACTCGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085495.2-1190s21c1
Sequence:CCGGGTCGCTATCCTCCGCAGATAACTCGAGTTATCTGCGGAGGATAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085495.2-4567s21c1
Sequence:CCGGGCAATTGCATGTTGGATATTTCTCGAGAAATATCCAACATGCAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085495
VALIDATED
ARFGEF2 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085495.2-1685s21c1
Sequence:CCGGCCAGTGCGTTGTGGATATTTACTCGAGTAAATATCCACAACGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085495.2-320s21c1
Sequence:CCGGCATTGAAGCTGACAAGTATTTCTCGAGAAATACTTGTCAGCTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085495.2-6793s21c1
Sequence:CCGGTACATCGAGTCCTACGAATTGCTCGAGCAATTCGTAGGACTCGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085495.2-1190s21c1
Sequence:CCGGGTCGCTATCCTCCGCAGATAACTCGAGTTATCTGCGGAGGATAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085495.2-4567s21c1
Sequence:CCGGGCAATTGCATGTTGGATATTTCTCGAGAAATATCCAACATGCAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085495
VALIDATED
ARFGEF2 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085495.2-1685s21c1
Sequence:CCGGCCAGTGCGTTGTGGATATTTACTCGAGTAAATATCCACAACGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085495.2-320s21c1
Sequence:CCGGCATTGAAGCTGACAAGTATTTCTCGAGAAATACTTGTCAGCTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085495.2-6793s21c1
Sequence:CCGGTACATCGAGTCCTACGAATTGCTCGAGCAATTCGTAGGACTCGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085495.2-1190s21c1
Sequence:CCGGGTCGCTATCCTCCGCAGATAACTCGAGTTATCTGCGGAGGATAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085495.2-4567s21c1
Sequence:CCGGGCAATTGCATGTTGGATATTTCTCGAGAAATATCCAACATGCAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006420
ARFGEF2 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000047313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006420.1-5584s1c1
Sequence:CCGGGCTTCATTTCTATCATTCCATCTCGAGATGGAATGATAGAAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006420.1-2904s1c1
Sequence:CCGGCGACACCATTAAGACGCTTATCTCGAGATAAGCGTCTTAATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006420.1-1899s1c1
Sequence:CCGGCCCTGAGCAATTTGAGGTCATCTCGAGATGACCTCAAATTGCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006420.1-4525s1c1
Sequence:CCGGCGCCAGTCTTTAAGCAGCATACTCGAGTATGCTGCTTAAAGACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006420
ARFGEF2 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000047313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006420.1-5584s1c1
Sequence:CCGGGCTTCATTTCTATCATTCCATCTCGAGATGGAATGATAGAAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006420.1-2904s1c1
Sequence:CCGGCGACACCATTAAGACGCTTATCTCGAGATAAGCGTCTTAATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006420.1-1899s1c1
Sequence:CCGGCCCTGAGCAATTTGAGGTCATCTCGAGATGACCTCAAATTGCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006420.1-4525s1c1
Sequence:CCGGCGCCAGTCTTTAAGCAGCATACTCGAGTATGCTGCTTAAAGACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006420
ARFGEF2 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000047313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006420.1-5584s1c1
Sequence:CCGGGCTTCATTTCTATCATTCCATCTCGAGATGGAATGATAGAAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006420.1-2904s1c1
Sequence:CCGGCGACACCATTAAGACGCTTATCTCGAGATAAGCGTCTTAATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006420.1-1899s1c1
Sequence:CCGGCCCTGAGCAATTTGAGGTCATCTCGAGATGACCTCAAATTGCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006420.1-4525s1c1
Sequence:CCGGCGCCAGTCTTTAAGCAGCATACTCGAGTATGCTGCTTAAAGACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks