EMAIL THIS PAGE TO A FRIEND

ARFIP1

ADP-ribosylation factor interacting protein 1

219 Gene Product Result for
Synonyms: HSU52521
UniProtKB ID: P53367, Q2M2X4, Q3SYL4, Q9Y2X6
Gene ID:
Mouse(99889) ADP-ribosylation factor interacting protein 1
Rat(60382) ADP-ribosylation factor interacting protein 1
sheep(101103593) ADP-ribosylation factor interacting protein 1
naked mole-rat(101719595) ADP-ribosylation factor interacting protein 1
domestic guinea pig(100712951) ADP-ribosylation factor interacting protein 1
Zebrafish(100003895) ADP-ribosylation factor interacting protein 1 (arfaptin 1)
dog(475467) ADP-ribosylation factor interacting protein 1
cow(507386) ADP-ribosylation factor interacting protein 1
Horse(100629457) ADP-ribosylation factor interacting protein 1
domestic cat(101095097) ADP-ribosylation factor interacting protein 1
chicken(770884) ADP-ribosylation factor interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_130985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014447 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025593 Rosetta Predictions human pricing
NM_001025595 Rosetta Predictions human pricing
NM_014447 Rosetta Predictions human pricing
NM_021763 Rosetta Predictions rat pricing
NM_001081093 Rosetta Predictions mouse pricing
XM_130985 Rosetta Predictions mouse pricing
XM_890734 Rosetta Predictions mouse pricing
XM_899192 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058169 predicted 1022
2 SASI_Hs01_00058170 predicted 899
3 SASI_Hs01_00058171 predicted 770
4 SASI_Hs01_00058172 predicted 1321
5 SASI_Hs01_00058174 predicted 968
6 SASI_Hs01_00058175 predicted 772
7 SASI_Hs02_00307472 predicted 744
8 SASI_Hs01_00058176 predicted 953
9 SASI_Hs01_00058177 predicted 1386
10 SASI_Hs01_00058178 predicted 835
11 SASI_Hs01_00058173 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127548 predicted 1125
2 SASI_Hs01_00127549 predicted 997
3 SASI_Hs01_00127550 predicted 861
4 SASI_Hs01_00127551 predicted 1415
5 SASI_Hs01_00127553 predicted 1057
6 SASI_Hs01_00127554 predicted 870
7 SASI_Hs02_00307473 predicted 836
8 SASI_Hs01_00127555 predicted 1051
9 SASI_Hs01_00127556 predicted 1481
10 SASI_Hs01_00127557 predicted 926
11 SASI_Hs01_00127552 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083425 predicted 895
2 SASI_Hs01_00083426 predicted 758
3 SASI_Hs01_00083427 predicted 631
4 SASI_Hs01_00083428 predicted 1180
5 SASI_Hs01_00083430 predicted 827
6 SASI_Hs01_00083431 predicted 631
7 SASI_Hs02_00345656 predicted 603
8 SASI_Hs01_00083432 predicted 824
9 SASI_Hs01_00083433 predicted 1253
10 SASI_Hs01_00083434 predicted 699
11 SASI_Hs01_00083429 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064219 predicted 455
2 SASI_Rn01_00064220 predicted 876
3 SASI_Rn01_00064221 predicted 496
4 SASI_Rn01_00064222 predicted 1192
5 SASI_Rn01_00064223 predicted 995
6 SASI_Rn01_00064224 predicted 1222
7 SASI_Rn01_00064225 predicted 540
8 SASI_Rn02_00262823 predicted 655
9 SASI_Rn01_00064226 predicted 461
10 SASI_Rn01_00064227 predicted 666
11 SASI_Rn01_00064228 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295111 predicted 256
2 SASI_Mm02_00295112 predicted 1387
3 SASI_Mm02_00295113 predicted 656
4 SASI_Mm02_00295114 predicted 1272
5 SASI_Mm02_00295115 predicted 673
6 SASI_Mm02_00295116 predicted 1241
7 SASI_Mm02_00295117 predicted 1392
8 SASI_Mm02_00295118 predicted 645
9 SASI_Mm02_00295119 predicted 691
10 SASI_Mm02_00295120 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249806 predicted 259
2 SASI_Mm01_00249807 predicted 1388
3 SASI_Mm01_00249808 predicted 665
4 SASI_Mm01_00249809 predicted 680
5 SASI_Mm01_00249810 predicted 1278
6 SASI_Mm01_00249811 predicted 1248
7 SASI_Mm01_00249812 predicted 1396
8 SASI_Mm01_00249813 predicted 695
9 SASI_Mm01_00249814 predicted 1014
10 SASI_Mm01_00249815 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263395 predicted 1136
2 SASI_Mm01_00263396 predicted 417
3 SASI_Mm01_00263397 predicted 434
4 SASI_Mm01_00263398 predicted 1038
5 SASI_Mm01_00263399 predicted 1000
6 SASI_Mm01_00263400 predicted 1148
7 SASI_Mm01_00263401 predicted 734
8 SASI_Mm01_00263402 predicted 396
9 SASI_Mm01_00263403 predicted 449
10 SASI_Mm01_00263404 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253378 predicted 1065
2 SASI_Mm01_00253379 predicted 334
3 SASI_Mm01_00253380 predicted 359
4 SASI_Mm01_00253381 predicted 955
5 SASI_Mm01_00253382 predicted 922
6 SASI_Mm01_00253383 predicted 1079
7 SASI_Mm01_00253384 predicted 657
8 SASI_Mm01_00253385 predicted 326
9 SASI_Mm01_00253386 predicted 373
10 SASI_Mm01_00253387 predicted 691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130985
VALIDATED
ARFIP1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor interacting protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130985.4-1362s1c1
Sequence:CCGGCGGTGTATTGTTAAACAACTACTCGAGTAGTTGTTTAACAATACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130985.4-429s1c1
Sequence:CCGGGCACCACCTTTGCCATGTGTTCTCGAGAACACATGGCAAAGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130985.4-246s1c1
Sequence:CCGGGCAGCAGAAATCCCAGTAACTCTCGAGAGTTACTGGGATTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130985.4-1140s1c1
Sequence:CCGGCGCAGTGATGTTTCTGTCAAACTCGAGTTTGACAGAAACATCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130985.4-635s1c1
Sequence:CCGGCCGGCAAATTATATCTGAGAACTCGAGTTCTCAGATATAATTTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130985
VALIDATED
ARFIP1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor interacting protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130985.4-1362s1c1
Sequence:CCGGCGGTGTATTGTTAAACAACTACTCGAGTAGTTGTTTAACAATACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130985.4-429s1c1
Sequence:CCGGGCACCACCTTTGCCATGTGTTCTCGAGAACACATGGCAAAGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130985.4-246s1c1
Sequence:CCGGGCAGCAGAAATCCCAGTAACTCTCGAGAGTTACTGGGATTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130985.4-1140s1c1
Sequence:CCGGCGCAGTGATGTTTCTGTCAAACTCGAGTTTGACAGAAACATCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130985.4-635s1c1
Sequence:CCGGCCGGCAAATTATATCTGAGAACTCGAGTTCTCAGATATAATTTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130985
VALIDATED
ARFIP1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor interacting protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130985.4-1362s1c1
Sequence:CCGGCGGTGTATTGTTAAACAACTACTCGAGTAGTTGTTTAACAATACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130985.4-429s1c1
Sequence:CCGGGCACCACCTTTGCCATGTGTTCTCGAGAACACATGGCAAAGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130985.4-246s1c1
Sequence:CCGGGCAGCAGAAATCCCAGTAACTCTCGAGAGTTACTGGGATTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130985.4-1140s1c1
Sequence:CCGGCGCAGTGATGTTTCTGTCAAACTCGAGTTTGACAGAAACATCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130985.4-635s1c1
Sequence:CCGGCCGGCAAATTATATCTGAGAACTCGAGTTCTCAGATATAATTTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014447
VALIDATED
ARFIP1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor interacting protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014447.1-955s1c1
Sequence:CCGGGCGCAATGATGTTTCTGTCAACTCGAGTTGACAGAAACATCATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014447.1-281s1c1
Sequence:CCGGCATGGCTTTGACAATACCAAACTCGAGTTTGGTATTGTCAAAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014447.1-822s1c1
Sequence:CCGGCCAGGATTGAATATGATGCATCTCGAGATGCATCATATTCAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014447.1-362s1c1
Sequence:CCGGCCAGTTATTCTAGCAGATGAACTCGAGTTCATCTGCTAGAATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014447.1-201s1c1
Sequence:CCGGCTCGTGAACATAGCTTTAATACTCGAGTATTAAAGCTATGTTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014447.2-435s21c1
Sequence:CCGGATGGAGTCTAAACACCTATAACTCGAGTTATAGGTGTTTAGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014447.2-966s21c1
Sequence:CCGGGCGCAATGATGTTTCTGTCAACTCGAGTTGACAGAAACATCATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014447.2-676s21c1
Sequence:CCGGCATGAAGAATTTGGCTATAATCTCGAGATTATAGCCAAATTCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014447.2-212s21c1
Sequence:CCGGCTCGTGAACATAGCTTTAATACTCGAGTATTAAAGCTATGTTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014447.2-373s21c1
Sequence:CCGGCCAGTTATTCTAGCAGATGAACTCGAGTTCATCTGCTAGAATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014447
VALIDATED
ARFIP1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor interacting protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014447.1-955s1c1
Sequence:CCGGGCGCAATGATGTTTCTGTCAACTCGAGTTGACAGAAACATCATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014447.1-281s1c1
Sequence:CCGGCATGGCTTTGACAATACCAAACTCGAGTTTGGTATTGTCAAAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014447.1-822s1c1
Sequence:CCGGCCAGGATTGAATATGATGCATCTCGAGATGCATCATATTCAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014447.1-362s1c1
Sequence:CCGGCCAGTTATTCTAGCAGATGAACTCGAGTTCATCTGCTAGAATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014447.1-201s1c1
Sequence:CCGGCTCGTGAACATAGCTTTAATACTCGAGTATTAAAGCTATGTTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014447.2-435s21c1
Sequence:CCGGATGGAGTCTAAACACCTATAACTCGAGTTATAGGTGTTTAGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014447.2-966s21c1
Sequence:CCGGGCGCAATGATGTTTCTGTCAACTCGAGTTGACAGAAACATCATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014447.2-676s21c1
Sequence:CCGGCATGAAGAATTTGGCTATAATCTCGAGATTATAGCCAAATTCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014447.2-212s21c1
Sequence:CCGGCTCGTGAACATAGCTTTAATACTCGAGTATTAAAGCTATGTTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014447.2-373s21c1
Sequence:CCGGCCAGTTATTCTAGCAGATGAACTCGAGTTCATCTGCTAGAATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014447
VALIDATED
ARFIP1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor interacting protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014447.1-955s1c1
Sequence:CCGGGCGCAATGATGTTTCTGTCAACTCGAGTTGACAGAAACATCATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014447.1-281s1c1
Sequence:CCGGCATGGCTTTGACAATACCAAACTCGAGTTTGGTATTGTCAAAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014447.1-822s1c1
Sequence:CCGGCCAGGATTGAATATGATGCATCTCGAGATGCATCATATTCAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014447.1-362s1c1
Sequence:CCGGCCAGTTATTCTAGCAGATGAACTCGAGTTCATCTGCTAGAATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014447.1-201s1c1
Sequence:CCGGCTCGTGAACATAGCTTTAATACTCGAGTATTAAAGCTATGTTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014447.2-435s21c1
Sequence:CCGGATGGAGTCTAAACACCTATAACTCGAGTTATAGGTGTTTAGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014447.2-966s21c1
Sequence:CCGGGCGCAATGATGTTTCTGTCAACTCGAGTTGACAGAAACATCATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014447.2-676s21c1
Sequence:CCGGCATGAAGAATTTGGCTATAATCTCGAGATTATAGCCAAATTCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014447.2-212s21c1
Sequence:CCGGCTCGTGAACATAGCTTTAATACTCGAGTATTAAAGCTATGTTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014447.2-373s21c1
Sequence:CCGGCCAGTTATTCTAGCAGATGAACTCGAGTTCATCTGCTAGAATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks