EMAIL THIS PAGE TO A FRIEND

ARFIP2

ADP-ribosylation factor interacting protein 2

131 Gene Product Result for
Synonyms: POR1
UniProtKB ID: P53365, B4DX86, B4E306, D3DQT5
Gene ID:
Mouse(76932) ADP-ribosylation factor interacting protein 2
Rat(293344) ADP-ribosylation factor interacting protein 2
chicken(419075) ADP-ribosylation factor interacting protein 2
cow(514938) ADP-ribosylation factor interacting protein 2
domestic cat(101091810) ADP-ribosylation factor interacting protein 2
dog(610132) ADP-ribosylation factor interacting protein 2
domestic guinea pig(100734507) ADP-ribosylation factor interacting protein 2
naked mole-rat(101704069) ADP-ribosylation factor interacting protein 2
sheep(100302307) ADP-ribosylation factor interacting protein 2
Domestic Rabbit(100354840) ADP-ribosylation factor interacting protein 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012402 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019901 MISSION® esiRNA esiRNA human ARFIP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012402 Rosetta Predictions human pricing
NM_001004222 Rosetta Predictions rat pricing
NM_029802 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344226 predicted 694
2 SASI_Hs02_00344227 predicted 452
3 SASI_Hs02_00344228 predicted 700
4 SASI_Hs02_00344229 predicted 799
5 SASI_Hs02_00344230 predicted 450
6 SASI_Hs02_00344231 predicted 438
7 SASI_Hs02_00344232 predicted 436
8 SASI_Hs02_00344233 predicted 683
9 SASI_Hs02_00344234 predicted 1228
10 SASI_Hs02_00344235 predicted 851
11 SASI_Hs01_00053398 predicted 280
12 SASI_Hs01_00053399 predicted 1170
13 SASI_Hs01_00053400 predicted 1567
14 SASI_Hs01_00053401 predicted 1645
15 SASI_Hs01_00053402 predicted 984
16 SASI_Hs01_00053403 predicted 1548
17 SASI_Hs01_00053404 predicted 1539
18 SASI_Hs01_00053405 predicted 1354
19 SASI_Hs01_00053406 predicted 988
20 SASI_Hs01_00053407 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116789 predicted 976
2 SASI_Rn01_00116790 predicted 621
3 SASI_Rn01_00116791 predicted 275
4 SASI_Rn01_00116792 predicted 488
5 SASI_Rn02_00198215 predicted 248
6 SASI_Rn01_00116793 predicted 1209
7 SASI_Rn01_00116794 predicted 1170
8 SASI_Rn01_00116795 predicted 1087
9 SASI_Rn02_00198216 predicted 408
10 SASI_Rn01_00116797 predicted 1067
11 SASI_Rn01_00116796 predicted 790
12 SASI_Rn01_00116798 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335963 predicted 801
2 SASI_Mm01_00102985 predicted 979
3 SASI_Mm02_00335964 predicted 624
4 SASI_Mm01_00102986 predicted 284
5 SASI_Mm02_00335965 predicted 258
6 SASI_Mm02_00335966 predicted 501
7 SASI_Mm01_00102989 predicted 1179
8 SASI_Mm02_00335967 predicted 669
9 SASI_Mm02_00335968 predicted 1458
10 SASI_Mm02_00335969 predicted 798
11 SASI_Mm01_00102987 predicted 235
12 SASI_Mm01_00102988 predicted 857
13 SASI_Mm01_00102990 predicted 854
14 SASI_Mm01_00102991 predicted 1020
15 SASI_Mm01_00102992 predicted 921
16 SASI_Mm01_00102993 predicted 806
17 SASI_Mm01_00102994 predicted 1198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029802
VALIDATED
ARFIP2 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor interacting protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029802.4-252s21c1
Sequence:CCGGAGATTCCCATCCACGGAAATGCTCGAGCATTTCCGTGGATGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029802.4-823s21c1
Sequence:CCGGGAACTTCTTTGTCTCTAGCATCTCGAGATGCTAGAGACAAAGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029802.4-614s21c1
Sequence:CCGGCGTGAGACGAAGCGCAAGTATCTCGAGATACTTGCGCTTCGTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029802.4-1010s21c1
Sequence:CCGGCAGACCCATCGGGACAAATATCTCGAGATATTTGTCCCGATGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029802.4-1165s21c1
Sequence:CCGGGCAGACTCTTCAGCAGTTCAACTCGAGTTGAACTGCTGAAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-1655s1c1
Sequence:CCGGCCTCCTCAATGTGTGTCCATTCTCGAGAATGGACACACATTGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-1146s1c1
Sequence:CCGGGCAGACTCTTCAGCAGTTCAACTCGAGTTGAACTGCTGAAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-804s1c1
Sequence:CCGGGAACTTCTTTGTCTCTAGCATCTCGAGATGCTAGAGACAAAGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-232s1c1
Sequence:CCGGGAGATTCCCATCCACGGAAATCTCGAGATTTCCGTGGATGGGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-595s1c1
Sequence:CCGGCGTGAGACGAAGCGCAAGTATCTCGAGATACTTGCGCTTCGTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029802
VALIDATED
ARFIP2 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor interacting protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029802.4-252s21c1
Sequence:CCGGAGATTCCCATCCACGGAAATGCTCGAGCATTTCCGTGGATGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029802.4-823s21c1
Sequence:CCGGGAACTTCTTTGTCTCTAGCATCTCGAGATGCTAGAGACAAAGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029802.4-614s21c1
Sequence:CCGGCGTGAGACGAAGCGCAAGTATCTCGAGATACTTGCGCTTCGTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029802.4-1010s21c1
Sequence:CCGGCAGACCCATCGGGACAAATATCTCGAGATATTTGTCCCGATGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029802.4-1165s21c1
Sequence:CCGGGCAGACTCTTCAGCAGTTCAACTCGAGTTGAACTGCTGAAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-1655s1c1
Sequence:CCGGCCTCCTCAATGTGTGTCCATTCTCGAGAATGGACACACATTGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-1146s1c1
Sequence:CCGGGCAGACTCTTCAGCAGTTCAACTCGAGTTGAACTGCTGAAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-804s1c1
Sequence:CCGGGAACTTCTTTGTCTCTAGCATCTCGAGATGCTAGAGACAAAGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-232s1c1
Sequence:CCGGGAGATTCCCATCCACGGAAATCTCGAGATTTCCGTGGATGGGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-595s1c1
Sequence:CCGGCGTGAGACGAAGCGCAAGTATCTCGAGATACTTGCGCTTCGTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029802
VALIDATED
ARFIP2 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor interacting protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029802.4-252s21c1
Sequence:CCGGAGATTCCCATCCACGGAAATGCTCGAGCATTTCCGTGGATGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029802.4-823s21c1
Sequence:CCGGGAACTTCTTTGTCTCTAGCATCTCGAGATGCTAGAGACAAAGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029802.4-614s21c1
Sequence:CCGGCGTGAGACGAAGCGCAAGTATCTCGAGATACTTGCGCTTCGTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029802.4-1010s21c1
Sequence:CCGGCAGACCCATCGGGACAAATATCTCGAGATATTTGTCCCGATGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029802.4-1165s21c1
Sequence:CCGGGCAGACTCTTCAGCAGTTCAACTCGAGTTGAACTGCTGAAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-1655s1c1
Sequence:CCGGCCTCCTCAATGTGTGTCCATTCTCGAGAATGGACACACATTGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-1146s1c1
Sequence:CCGGGCAGACTCTTCAGCAGTTCAACTCGAGTTGAACTGCTGAAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-804s1c1
Sequence:CCGGGAACTTCTTTGTCTCTAGCATCTCGAGATGCTAGAGACAAAGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-232s1c1
Sequence:CCGGGAGATTCCCATCCACGGAAATCTCGAGATTTCCGTGGATGGGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029802.2-595s1c1
Sequence:CCGGCGTGAGACGAAGCGCAAGTATCTCGAGATACTTGCGCTTCGTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012402
VALIDATED
ARFIP2 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor interacting protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012402.2-702s21c1
Sequence:CCGGCAGAAACTACTATGCAAGAATCTCGAGATTCTTGCATAGTAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012402.2-259s21c1
Sequence:CCGGCAGGACCCAACCTCAATGAAACTCGAGTTTCATTGAGGTTGGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012402.2-461s21c1
Sequence:CCGGGCAACTGTTATCAGAACGATTCTCGAGAATCGTTCTGATAACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012402.2-672s21c1
Sequence:CCGGCAGGAGGAATTTGGCTACAATCTCGAGATTGTAGCCAAATTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012402.2-461s1c1
Sequence:CCGGGCAACTGTTATCAGAACGATTCTCGAGAATCGTTCTGATAACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012402.2-938s1c1
Sequence:CCGGCCATCGGGACAAGTATGAGAACTCGAGTTCTCATACTTGTCCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012402.2-702s1c1
Sequence:CCGGCAGAAACTACTATGCAAGAATCTCGAGATTCTTGCATAGTAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012402.2-259s1c1
Sequence:CCGGCAGGACCCAACCTCAATGAAACTCGAGTTTCATTGAGGTTGGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012402.2-672s1c1
Sequence:CCGGCAGGAGGAATTTGGCTACAATCTCGAGATTGTAGCCAAATTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012402
VALIDATED
ARFIP2 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor interacting protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012402.2-702s21c1
Sequence:CCGGCAGAAACTACTATGCAAGAATCTCGAGATTCTTGCATAGTAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012402.2-259s21c1
Sequence:CCGGCAGGACCCAACCTCAATGAAACTCGAGTTTCATTGAGGTTGGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012402.2-461s21c1
Sequence:CCGGGCAACTGTTATCAGAACGATTCTCGAGAATCGTTCTGATAACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012402.2-672s21c1
Sequence:CCGGCAGGAGGAATTTGGCTACAATCTCGAGATTGTAGCCAAATTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012402.2-461s1c1
Sequence:CCGGGCAACTGTTATCAGAACGATTCTCGAGAATCGTTCTGATAACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012402.2-938s1c1
Sequence:CCGGCCATCGGGACAAGTATGAGAACTCGAGTTCTCATACTTGTCCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012402.2-702s1c1
Sequence:CCGGCAGAAACTACTATGCAAGAATCTCGAGATTCTTGCATAGTAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012402.2-259s1c1
Sequence:CCGGCAGGACCCAACCTCAATGAAACTCGAGTTTCATTGAGGTTGGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012402.2-672s1c1
Sequence:CCGGCAGGAGGAATTTGGCTACAATCTCGAGATTGTAGCCAAATTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012402
VALIDATED
ARFIP2 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor interacting protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012402.2-702s21c1
Sequence:CCGGCAGAAACTACTATGCAAGAATCTCGAGATTCTTGCATAGTAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012402.2-259s21c1
Sequence:CCGGCAGGACCCAACCTCAATGAAACTCGAGTTTCATTGAGGTTGGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012402.2-461s21c1
Sequence:CCGGGCAACTGTTATCAGAACGATTCTCGAGAATCGTTCTGATAACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012402.2-672s21c1
Sequence:CCGGCAGGAGGAATTTGGCTACAATCTCGAGATTGTAGCCAAATTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012402.2-461s1c1
Sequence:CCGGGCAACTGTTATCAGAACGATTCTCGAGAATCGTTCTGATAACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012402.2-938s1c1
Sequence:CCGGCCATCGGGACAAGTATGAGAACTCGAGTTCTCATACTTGTCCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012402.2-702s1c1
Sequence:CCGGCAGAAACTACTATGCAAGAATCTCGAGATTCTTGCATAGTAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012402.2-259s1c1
Sequence:CCGGCAGGACCCAACCTCAATGAAACTCGAGTTTCATTGAGGTTGGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012402.2-672s1c1
Sequence:CCGGCAGGAGGAATTTGGCTACAATCTCGAGATTGTAGCCAAATTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks