EMAIL THIS PAGE TO A FRIEND

ARFRP1

ADP-ribosylation factor related protein 1

62 Gene Product Result for
Synonyms: ARL18 ARP Arp1
UniProtKB ID: Q13795, B7ZKX7, E1P5J9, Q6IBQ0
Gene ID:
Human(10139) Summary: The protein encoded by this gene is a membrane-associated GTP-ase which localizes to the plasma membrane and is related to the ADP-ribosylation factor (ARF) and ARF-like (ARL) proteins. This gene plays a role in membrane trafficking between the trans-Golgi network and endosomes. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
Mouse(76688) ADP-ribosylation factor related protein 1
Rat(117051) ADP-ribosylation factor related protein 1
naked mole-rat(101726466) ADP-ribosylation factor related protein 1
domestic guinea pig(100730245) ADP-ribosylation factor related protein 1
sheep(100302308) ADP-ribosylation factor related protein 1
Zebrafish(503602) ADP-ribosylation factor related protein 1
cow(525394) ADP-ribosylation factor related protein 1
domestic cat(101093512) ADP-ribosylation factor related protein 1
dog(612540) ADP-ribosylation factor related protein 1
chicken(419261) ADP-ribosylation factor related protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003224 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU059431 MISSION® esiRNA esiRNA targeting mouse Arfrp1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003224 Rosetta Predictions human pricing
NM_053980 Rosetta Predictions rat pricing
NM_029702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107152 predicted 678
2 SASI_Hs01_00107153 predicted 887
3 SASI_Hs01_00107157 predicted 1225
4 SASI_Hs01_00107158 predicted 429
5 SASI_Hs01_00107159 predicted 353
6 SASI_Hs01_00107160 predicted 386
7 SASI_Hs02_00335260 predicted 353
8 SASI_Hs01_00107161 predicted 255
9 SASI_Hs02_00335261 predicted 606
10 SASI_Hs02_00335262 predicted 395
11 SASI_Hs01_00107154 predicted 212
12 SASI_Hs01_00107155 predicted 555
13 SASI_Hs01_00107156 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266972 predicted 508
2 SASI_Rn01_00068830 predicted 378
3 SASI_Rn01_00068831 predicted 392
4 SASI_Rn01_00068832 predicted 568
5 SASI_Rn02_00266973 predicted 409
6 SASI_Rn02_00266974 predicted 449
7 SASI_Rn01_00068833 predicted 672
8 SASI_Rn01_00068834 predicted 252
9 SASI_Rn02_00266975 predicted 605
10 SASI_Rn01_00068835 predicted 686
11 SASI_Rn01_00068829 predicted 259
12 SASI_Rn01_00068836 predicted 664
13 SASI_Rn01_00068837 predicted 607
14 SASI_Rn01_00068838 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145495 predicted 689
2 SASI_Mm01_00145496 predicted 529
3 SASI_Mm01_00145497 predicted 792
4 SASI_Mm01_00145498 predicted 705
5 SASI_Mm01_00145499 predicted 405
6 SASI_Mm01_00145500 predicted 564
7 SASI_Mm01_00145501 predicted 438
8 SASI_Mm01_00145502 predicted 438
9 SASI_Mm01_00145503 predicted 324
10 SASI_Mm01_00145504 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029702
VALIDATED
ARFRP1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor related protein 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029702.2-1104s1c1
Sequence:CCGGGCCTGGTTCAAAGTGGAATTTCTCGAGAAATTCCACTTTGAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029702.2-197s1c1
Sequence:CCGGCCAGAAGGATGAATACTGCATCTCGAGATGCAGTATTCATCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029702.2-590s1c1
Sequence:CCGGTCCTGACATCAAGACTGCATTCTCGAGAATGCAGTCTTGATGTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029702.2-463s1c1
Sequence:CCGGCCACTGATGAAGAAAGGCTGTCTCGAGACAGCCTTTCTTCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029702.2-437s1c1
Sequence:CCGGCCATGGTGTCATCTATGTAATCTCGAGATTACATAGATGACACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029702.3-1224s21c1
Sequence:GTACCGGGCTTACCTCACTTGGAGAAAGCTCGAGCTTTCTCCAAGTGAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029702.3-1083s21c1
Sequence:GTACCGGATGCCTAGGCCTGTTAGTTAGCTCGAGCTAACTAACAGGCCTAGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-462s21c1
Sequence:CCGGCCACTGATGAAGAAAGGCTGTCTCGAGACAGCCTTTCTTCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-190s21c1
Sequence:CCGGCATGTTCCAGAAGGATGAATACTCGAGTATTCATCCTTCTGGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-797s21c1
Sequence:CCGGCCTAGTGTTGGAAGAGTATTCCTCGAGGAATACTCTTCCAACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-317s21c1
Sequence:CCGGACCACTACCGTGGGTCTAAACCTCGAGGTTTAGACCCACGGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-408s21c1
Sequence:CCGGCTTTGTGGGACAAGTACTATGCTCGAGCATAGTACTTGTCCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029702
VALIDATED
ARFRP1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor related protein 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029702.2-1104s1c1
Sequence:CCGGGCCTGGTTCAAAGTGGAATTTCTCGAGAAATTCCACTTTGAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029702.2-197s1c1
Sequence:CCGGCCAGAAGGATGAATACTGCATCTCGAGATGCAGTATTCATCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029702.2-590s1c1
Sequence:CCGGTCCTGACATCAAGACTGCATTCTCGAGAATGCAGTCTTGATGTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029702.2-463s1c1
Sequence:CCGGCCACTGATGAAGAAAGGCTGTCTCGAGACAGCCTTTCTTCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029702.2-437s1c1
Sequence:CCGGCCATGGTGTCATCTATGTAATCTCGAGATTACATAGATGACACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029702.3-1224s21c1
Sequence:GTACCGGGCTTACCTCACTTGGAGAAAGCTCGAGCTTTCTCCAAGTGAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029702.3-1083s21c1
Sequence:GTACCGGATGCCTAGGCCTGTTAGTTAGCTCGAGCTAACTAACAGGCCTAGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-462s21c1
Sequence:CCGGCCACTGATGAAGAAAGGCTGTCTCGAGACAGCCTTTCTTCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-190s21c1
Sequence:CCGGCATGTTCCAGAAGGATGAATACTCGAGTATTCATCCTTCTGGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-797s21c1
Sequence:CCGGCCTAGTGTTGGAAGAGTATTCCTCGAGGAATACTCTTCCAACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-317s21c1
Sequence:CCGGACCACTACCGTGGGTCTAAACCTCGAGGTTTAGACCCACGGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-408s21c1
Sequence:CCGGCTTTGTGGGACAAGTACTATGCTCGAGCATAGTACTTGTCCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029702
VALIDATED
ARFRP1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor related protein 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029702.2-1104s1c1
Sequence:CCGGGCCTGGTTCAAAGTGGAATTTCTCGAGAAATTCCACTTTGAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029702.2-197s1c1
Sequence:CCGGCCAGAAGGATGAATACTGCATCTCGAGATGCAGTATTCATCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029702.2-590s1c1
Sequence:CCGGTCCTGACATCAAGACTGCATTCTCGAGAATGCAGTCTTGATGTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029702.2-463s1c1
Sequence:CCGGCCACTGATGAAGAAAGGCTGTCTCGAGACAGCCTTTCTTCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029702.2-437s1c1
Sequence:CCGGCCATGGTGTCATCTATGTAATCTCGAGATTACATAGATGACACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029702.3-1224s21c1
Sequence:GTACCGGGCTTACCTCACTTGGAGAAAGCTCGAGCTTTCTCCAAGTGAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029702.3-1083s21c1
Sequence:GTACCGGATGCCTAGGCCTGTTAGTTAGCTCGAGCTAACTAACAGGCCTAGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-462s21c1
Sequence:CCGGCCACTGATGAAGAAAGGCTGTCTCGAGACAGCCTTTCTTCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-190s21c1
Sequence:CCGGCATGTTCCAGAAGGATGAATACTCGAGTATTCATCCTTCTGGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-797s21c1
Sequence:CCGGCCTAGTGTTGGAAGAGTATTCCTCGAGGAATACTCTTCCAACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-317s21c1
Sequence:CCGGACCACTACCGTGGGTCTAAACCTCGAGGTTTAGACCCACGGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029702.3-408s21c1
Sequence:CCGGCTTTGTGGGACAAGTACTATGCTCGAGCATAGTACTTGTCCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003224
VALIDATED
ARFRP1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor related protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003224.2-886s1c1
Sequence:CCGGCGAAGACAAACTTTCCTCTATCTCGAGATAGAGGAAAGTTTGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003224.2-265s1c1
Sequence:CCGGCCGATTTAACAAGAACTACAACTCGAGTTGTAGTTCTTGTTAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003224.2-394s1c1
Sequence:CCGGGCAGTCTTTGTGGGACAAGTACTCGAGTACTTGTCCCACAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003224.2-571s1c1
Sequence:CCGGCCTCTCAATCCCTGACATCAACTCGAGTTGATGTCAGGGATTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003224.2-356s1c1
Sequence:CCGGCGGCTCATGTTCTGGGACTTACTCGAGTAAGTCCCAGAACATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-216s21c1
Sequence:GTACCGGCAATGCTGGGAAGACGACCTTCTCGAGAAGGTCGTCTTCCCAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-300s21c1
Sequence:GTACCGGCACCACCGTGGGCCTAAACATCTCGAGATGTTTAGGCCCACGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003224.3-876s21c1
Sequence:CCGGCGAAGACAAACTTTCCTCTATCTCGAGATAGAGGAAAGTTTGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-419s21c1
Sequence:CCGGACGGCGTCATCTACGTCATTGCTCGAGCAATGACGTAGATGACGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-561s21c1
Sequence:CCGGCCTCTCAATCCCTGACATCAACTCGAGTTGATGTCAGGGATTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_003224.3-465s21c1
Sequence:CCGGTGAGTCCAAGCAGGCGTTTGACTCGAGTCAAACGCCTGCTTGGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-387s21c1
Sequence:GTACCGGGTCTTTGTGGGACAAGTATTACTCGAGTAATACTTGTCCCACAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003224
VALIDATED
ARFRP1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor related protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003224.2-886s1c1
Sequence:CCGGCGAAGACAAACTTTCCTCTATCTCGAGATAGAGGAAAGTTTGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003224.2-265s1c1
Sequence:CCGGCCGATTTAACAAGAACTACAACTCGAGTTGTAGTTCTTGTTAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003224.2-394s1c1
Sequence:CCGGGCAGTCTTTGTGGGACAAGTACTCGAGTACTTGTCCCACAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003224.2-571s1c1
Sequence:CCGGCCTCTCAATCCCTGACATCAACTCGAGTTGATGTCAGGGATTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003224.2-356s1c1
Sequence:CCGGCGGCTCATGTTCTGGGACTTACTCGAGTAAGTCCCAGAACATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-216s21c1
Sequence:GTACCGGCAATGCTGGGAAGACGACCTTCTCGAGAAGGTCGTCTTCCCAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-300s21c1
Sequence:GTACCGGCACCACCGTGGGCCTAAACATCTCGAGATGTTTAGGCCCACGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003224.3-876s21c1
Sequence:CCGGCGAAGACAAACTTTCCTCTATCTCGAGATAGAGGAAAGTTTGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-419s21c1
Sequence:CCGGACGGCGTCATCTACGTCATTGCTCGAGCAATGACGTAGATGACGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-561s21c1
Sequence:CCGGCCTCTCAATCCCTGACATCAACTCGAGTTGATGTCAGGGATTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_003224.3-465s21c1
Sequence:CCGGTGAGTCCAAGCAGGCGTTTGACTCGAGTCAAACGCCTGCTTGGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-387s21c1
Sequence:GTACCGGGTCTTTGTGGGACAAGTATTACTCGAGTAATACTTGTCCCACAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003224
VALIDATED
ARFRP1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor related protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003224.2-886s1c1
Sequence:CCGGCGAAGACAAACTTTCCTCTATCTCGAGATAGAGGAAAGTTTGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003224.2-265s1c1
Sequence:CCGGCCGATTTAACAAGAACTACAACTCGAGTTGTAGTTCTTGTTAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003224.2-394s1c1
Sequence:CCGGGCAGTCTTTGTGGGACAAGTACTCGAGTACTTGTCCCACAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003224.2-571s1c1
Sequence:CCGGCCTCTCAATCCCTGACATCAACTCGAGTTGATGTCAGGGATTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003224.2-356s1c1
Sequence:CCGGCGGCTCATGTTCTGGGACTTACTCGAGTAAGTCCCAGAACATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-216s21c1
Sequence:GTACCGGCAATGCTGGGAAGACGACCTTCTCGAGAAGGTCGTCTTCCCAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-300s21c1
Sequence:GTACCGGCACCACCGTGGGCCTAAACATCTCGAGATGTTTAGGCCCACGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003224.3-876s21c1
Sequence:CCGGCGAAGACAAACTTTCCTCTATCTCGAGATAGAGGAAAGTTTGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-419s21c1
Sequence:CCGGACGGCGTCATCTACGTCATTGCTCGAGCAATGACGTAGATGACGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-561s21c1
Sequence:CCGGCCTCTCAATCCCTGACATCAACTCGAGTTGATGTCAGGGATTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_003224.3-465s21c1
Sequence:CCGGTGAGTCCAAGCAGGCGTTTGACTCGAGTCAAACGCCTGCTTGGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003224.3-387s21c1
Sequence:GTACCGGGTCTTTGTGGGACAAGTATTACTCGAGTAATACTTGTCCCACAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks