EMAIL THIS PAGE TO A FRIEND

ARG2

arginase 2

74 Gene Product Result for
UniProtKB ID: P78540, B2R690, Q6FHY8
Gene ID:
Human(384) Summary: Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exists (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type II isoform encoded by this gene, is located in the mitochondria and expressed in extra-hepatic tissues, especially kidney. The physiologic role of this isoform is poorly understood; it is thought to play a role in nitric oxide and polyamine metabolism. Transcript variants of the type II gene resulting from the use of alternative polyadenylation sites have been described. [provided by RefSeq, Jul 2008]
Mouse(11847) arginase type II
Rat(29215) arginase 2
sheep(780468) arginase, type II
Domestic Rabbit(100008967) arginase, type II
Zebrafish(322614) arginase, type II
chicken(423272) arginase, type II
domestic cat(101092944) arginase, type II
cow(518752) arginase, type II
Horse(100034051) arginase, type II
dog(480364) arginase, type II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK112 Arginase Activity Assay Kit sufficient for 200 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001172 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001172 Rosetta Predictions human pricing
NM_019168 Rosetta Predictions rat pricing
NM_009705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062948 predicted 1047
2 SASI_Hs01_00062949 predicted 1066
3 SASI_Hs01_00062950 predicted 927
4 SASI_Hs02_00331298 predicted 773
5 SASI_Hs01_00062951 predicted 837
6 SASI_Hs01_00062952 predicted 960
7 SASI_Hs01_00062953 predicted 737
8 SASI_Hs01_00062954 predicted 1263
9 SASI_Hs01_00062955 predicted 1277
10 SASI_Hs01_00062956 predicted 839
11 SASI_Hs01_00062957 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066910 predicted 840
2 SASI_Rn01_00066911 predicted 1153
3 SASI_Rn01_00066912 predicted 337
4 SASI_Rn01_00066913 predicted 1044
5 SASI_Rn01_00066914 predicted 989
6 SASI_Rn01_00066915 predicted 300
7 SASI_Rn01_00066916 predicted 1113
8 SASI_Rn01_00066917 predicted 320
9 SASI_Rn01_00066918 predicted 847
10 SASI_Rn01_00066919 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051073 predicted 774
2 SASI_Mm01_00051074 predicted 318
3 SASI_Mm02_00316845 predicted 1136
4 SASI_Mm01_00051075 predicted 1027
5 SASI_Mm01_00051076 predicted 305
6 SASI_Mm01_00051077 predicted 732
7 SASI_Mm01_00051078 predicted 278
8 SASI_Mm02_00316846 predicted 1195
9 SASI_Mm01_00051079 predicted 823
10 SASI_Mm01_00051080 predicted 702
11 SASI_Mm01_00051081 predicted 874
12 SASI_Mm01_00051082 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009705
VALIDATED
ARG2 MISSION shRNA Bacterial Glycerol Stock
arginase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009705.1-1136s1c1
Sequence:CCGGGCACCTTTCACAACAGCATTACTCGAGTAATGCTGTTGTGAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009705.1-416s1c1
Sequence:CCGGGCCTGGCAATAGGTACCATTACTCGAGTAATGGTACCTATTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009705.1-284s1c1
Sequence:CCGGCACAAGATGATCCCTACAATACTCGAGTATTGTAGGGATCATCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009705.1-751s1c1
Sequence:CCGGCAGACATTTGATCGGCTGATTCTCGAGAATCAGCCGATCAAATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009705.1-540s1c1
Sequence:CCGGGCCACTTTCCTTTCTCATCAACTCGAGTTGATGAGAAAGGAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009705
VALIDATED
ARG2 MISSION shRNA shRNA Plasmid DNA
arginase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009705.1-1136s1c1
Sequence:CCGGGCACCTTTCACAACAGCATTACTCGAGTAATGCTGTTGTGAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009705.1-416s1c1
Sequence:CCGGGCCTGGCAATAGGTACCATTACTCGAGTAATGGTACCTATTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009705.1-284s1c1
Sequence:CCGGCACAAGATGATCCCTACAATACTCGAGTATTGTAGGGATCATCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009705.1-751s1c1
Sequence:CCGGCAGACATTTGATCGGCTGATTCTCGAGAATCAGCCGATCAAATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009705.1-540s1c1
Sequence:CCGGGCCACTTTCCTTTCTCATCAACTCGAGTTGATGAGAAAGGAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009705
VALIDATED
ARG2 MISSION shRNA Lentiviral Transduction Particles
arginase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009705.1-1136s1c1
Sequence:CCGGGCACCTTTCACAACAGCATTACTCGAGTAATGCTGTTGTGAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009705.1-416s1c1
Sequence:CCGGGCCTGGCAATAGGTACCATTACTCGAGTAATGGTACCTATTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009705.1-284s1c1
Sequence:CCGGCACAAGATGATCCCTACAATACTCGAGTATTGTAGGGATCATCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009705.1-751s1c1
Sequence:CCGGCAGACATTTGATCGGCTGATTCTCGAGAATCAGCCGATCAAATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009705.1-540s1c1
Sequence:CCGGGCCACTTTCCTTTCTCATCAACTCGAGTTGATGAGAAAGGAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001172
VALIDATED
ARG2 MISSION shRNA Bacterial Glycerol Stock
arginase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_001172.2-853s1c1
Sequence:CCGGCCTATCGAGAAGGCATGTATACTCGAGTATACATGCCTTCTCGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_001172.2-1060s1c1
Sequence:CCGGGTTCACCAGATGAATCAGAAACTCGAGTTTCTGATTCATCTGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-1093s21c1
Sequence:CCGGCAAGAGAAGGAGGGCATATTGCTCGAGCAATATGCCCTCCTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-568s21c1
Sequence:CCGGCCCTTACCACTTCATCAGGAACTCGAGTTCCTGATGAAGTGGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-931s21c1
Sequence:CCGGCCTATCGAGAAGGCATGTATACTCGAGTATACATGCCTTCTCGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-813s21c1
Sequence:CCGGCGAACATTTGATCTGCTGATTCTCGAGAATCAGCAGATCAAATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-746s21c1
Sequence:CCGGGAACTATGATATCCAGTATTTCTCGAGAAATACTGGATATCATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001172
VALIDATED
ARG2 MISSION shRNA shRNA Plasmid DNA
arginase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_001172.2-853s1c1
Sequence:CCGGCCTATCGAGAAGGCATGTATACTCGAGTATACATGCCTTCTCGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_001172.2-1060s1c1
Sequence:CCGGGTTCACCAGATGAATCAGAAACTCGAGTTTCTGATTCATCTGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-1093s21c1
Sequence:CCGGCAAGAGAAGGAGGGCATATTGCTCGAGCAATATGCCCTCCTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-568s21c1
Sequence:CCGGCCCTTACCACTTCATCAGGAACTCGAGTTCCTGATGAAGTGGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-931s21c1
Sequence:CCGGCCTATCGAGAAGGCATGTATACTCGAGTATACATGCCTTCTCGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-813s21c1
Sequence:CCGGCGAACATTTGATCTGCTGATTCTCGAGAATCAGCAGATCAAATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-746s21c1
Sequence:CCGGGAACTATGATATCCAGTATTTCTCGAGAAATACTGGATATCATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001172
VALIDATED
ARG2 MISSION shRNA Lentiviral Transduction Particles
arginase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_001172.2-853s1c1
Sequence:CCGGCCTATCGAGAAGGCATGTATACTCGAGTATACATGCCTTCTCGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_001172.2-1060s1c1
Sequence:CCGGGTTCACCAGATGAATCAGAAACTCGAGTTTCTGATTCATCTGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-1093s21c1
Sequence:CCGGCAAGAGAAGGAGGGCATATTGCTCGAGCAATATGCCCTCCTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-568s21c1
Sequence:CCGGCCCTTACCACTTCATCAGGAACTCGAGTTCCTGATGAAGTGGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-931s21c1
Sequence:CCGGCCTATCGAGAAGGCATGTATACTCGAGTATACATGCCTTCTCGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-813s21c1
Sequence:CCGGCGAACATTTGATCTGCTGATTCTCGAGAATCAGCAGATCAAATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001172.3-746s21c1
Sequence:CCGGGAACTATGATATCCAGTATTTCTCGAGAAATACTGGATATCATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks