EMAIL THIS PAGE TO A FRIEND

ARGFX

arginine-fifty homeobox

33 Gene Product Result for
UniProtKB ID: A6NJG6
Gene ID:
Human(503582) Summary: Homeobox genes encode DNA-binding proteins, many of which are thought to be involved in early embryonic development. Homeobox genes encode a DNA-binding domain of 60 to 63 amino acids referred to as the homeodomain. This gene is a member of the ARGFX homeobox gene family. [provided by RefSeq, Jul 2008]
domestic cat(101089386) arginine-fifty homeobox
cow(783691) arginine-fifty homeobox
Horse(100063093) arginine-fifty homeobox
sheep(101118848) arginine-fifty homeobox
domestic guinea pig(101787080) arginine-fifty homeobox
naked mole-rat(101721161) arginine-fifty homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012659 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058391 predicted 839
2 SASI_Hs02_00306200 predicted 789
3 SASI_Hs01_00058393 predicted 1018
4 SASI_Hs01_00058395 predicted 633
5 SASI_Hs02_00306201 predicted 635
6 SASI_Hs01_00058396 predicted 933
7 SASI_Hs01_00058397 predicted 811
8 SASI_Hs01_00058398 predicted 673
9 SASI_Hs01_00058399 predicted 1033
10 SASI_Hs02_00306202 predicted 748
11 SASI_Hs01_00058392 predicted 658
12 SASI_Hs01_00058394 predicted 1046
13 SASI_Hs01_00058400 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012659
ARGFX MISSION shRNA Bacterial Glycerol Stock
arginine-fifty homeobox
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012659.1-2433s1c1
Sequence:CCGGCCAGACATAATAAGAGGTGTACTCGAGTACACCTCTTATTATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012659.1-1016s1c1
Sequence:CCGGCAATATGGTAGACTTGGGATTCTCGAGAATCCCAAGTCTACCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012659.1-794s1c1
Sequence:CCGGGTACAATCTTCCTGATGAGAACTCGAGTTCTCATCAGGAAGATTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012659.1-750s1c1
Sequence:CCGGGCTTTGTACTCTGATGCCTATCTCGAGATAGGCATCAGAGTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012659.1-448s1c1
Sequence:CCGGCGGAGTCAACAGTAAAGGTTTCTCGAGAAACCTTTACTGTTGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012659
ARGFX MISSION shRNA shRNA Plasmid DNA
arginine-fifty homeobox
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012659.1-2433s1c1
Sequence:CCGGCCAGACATAATAAGAGGTGTACTCGAGTACACCTCTTATTATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012659.1-1016s1c1
Sequence:CCGGCAATATGGTAGACTTGGGATTCTCGAGAATCCCAAGTCTACCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012659.1-794s1c1
Sequence:CCGGGTACAATCTTCCTGATGAGAACTCGAGTTCTCATCAGGAAGATTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012659.1-750s1c1
Sequence:CCGGGCTTTGTACTCTGATGCCTATCTCGAGATAGGCATCAGAGTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012659.1-448s1c1
Sequence:CCGGCGGAGTCAACAGTAAAGGTTTCTCGAGAAACCTTTACTGTTGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012659
ARGFX MISSION shRNA Lentiviral Transduction Particles
arginine-fifty homeobox
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012659.1-2433s1c1
Sequence:CCGGCCAGACATAATAAGAGGTGTACTCGAGTACACCTCTTATTATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012659.1-1016s1c1
Sequence:CCGGCAATATGGTAGACTTGGGATTCTCGAGAATCCCAAGTCTACCATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012659.1-794s1c1
Sequence:CCGGGTACAATCTTCCTGATGAGAACTCGAGTTCTCATCAGGAAGATTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012659.1-750s1c1
Sequence:CCGGGCTTTGTACTCTGATGCCTATCTCGAGATAGGCATCAGAGTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012659.1-448s1c1
Sequence:CCGGCGGAGTCAACAGTAAAGGTTTCTCGAGAAACCTTTACTGTTGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks