EMAIL THIS PAGE TO A FRIEND

ARGLU1

arginine and glutamate rich 1

235 Gene Product Result for
UniProtKB ID: Q9NWB6, Q5T257, Q6IQ34
Gene ID:
Mouse(234023) arginine and glutamate rich 1
Rat(290912) arginine and glutamate rich 1
chicken(418765) arginine and glutamate rich 1
cow(540543) arginine and glutamate rich 1
domestic cat(101087702) arginine and glutamate rich 1
dog(611747) arginine and glutamate rich 1
naked mole-rat(101723408) arginine and glutamate rich 1
domestic guinea pig(101788081) arginine and glutamate rich 1
sheep(101115718) arginine and glutamate rich 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018011 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069481 MISSION® esiRNA esiRNA human ARGLU1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018011 Rosetta Predictions human pricing
NM_001024972 Rosetta Predictions rat pricing
NM_176849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351093 predicted 591
2 SASI_Hs02_00351094 predicted 357
3 SASI_Hs02_00351095 predicted 361
4 SASI_Hs02_00351096 predicted 366
5 SASI_Hs02_00351097 predicted 729
6 SASI_Hs01_00016125 predicted 705
7 SASI_Hs02_00351098 predicted 691
8 SASI_Hs02_00351099 predicted 571
9 SASI_Hs02_00351100 predicted 622
10 SASI_Hs02_00351101 predicted 726
11 SASI_Hs01_00016117 predicted 1417
12 SASI_Hs01_00016118 predicted 874
13 SASI_Hs01_00016119 predicted 1254
14 SASI_Hs01_00016120 predicted 1332
15 SASI_Hs01_00016121 predicted 1028
16 SASI_Hs01_00016122 predicted 883
17 SASI_Hs01_00016123 predicted 1474
18 SASI_Hs01_00016124 predicted 1236
19 SASI_Hs01_00016126 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202843 predicted 850
2 SASI_Rn01_00112403 predicted 521
3 SASI_Rn01_00112404 predicted 833
4 SASI_Rn01_00112406 predicted 732
5 SASI_Rn01_00112407 predicted 856
6 SASI_Rn01_00112408 predicted 577
7 SASI_Rn01_00112409 predicted 794
8 SASI_Rn01_00112410 predicted 652
9 SASI_Rn01_00112411 predicted 664
10 SASI_Rn02_00202844 predicted 688
11 SASI_Rn01_00112405 predicted 622
12 SASI_Rn01_00112412 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346762 predicted 865
2 SASI_Mm01_00120898 predicted 603
3 SASI_Mm02_00346763 predicted 537
4 SASI_Mm01_00120901 predicted 742
5 SASI_Mm02_00346764 predicted 659
6 SASI_Mm01_00120904 predicted 670
7 SASI_Mm02_00346765 predicted 536
8 SASI_Mm02_00346766 predicted 810
9 SASI_Mm02_00346767 predicted 628
10 SASI_Mm02_00346768 predicted 787
11 SASI_Mm01_00120897 predicted 1047
12 SASI_Mm01_00120899 predicted 939
13 SASI_Mm01_00120900 predicted 1098
14 SASI_Mm01_00120902 predicted 933
15 SASI_Mm01_00120903 predicted 805
16 SASI_Mm01_00120905 predicted 870
17 SASI_Mm01_00120906 predicted 1111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018011
VALIDATED
ARGLU1 MISSION shRNA Bacterial Glycerol Stock
arginine and glutamate rich 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018011.1-643s1c1
Sequence:CCGGGAGTAGAAGAATTGGTAGCAACTCGAGTTGCTACCAATTCTTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-981s1c1
Sequence:CCGGCGTCAACAGAAAGAAGAACAACTCGAGTTGTTCTTCTTTCTGTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018011.1-937s1c1
Sequence:CCGGGAAAGATTCATGAGGAAAGGACTCGAGTCCTTTCCTCATGAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-948s1c1
Sequence:CCGGGAGGAAAGGATGAAACTAGAACTCGAGTTCTAGTTTCATCCTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018011.1-849s1c1
Sequence:CCGGGAGCGAATACTGGAAGAGAATCTCGAGATTCTCTTCCAGTATTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018011.1-696s1c1
Sequence:CCGGGATGAAATTGAACGAGAAGTTCTCGAGAACTTCTCGTTCAATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018011.1-639s1c1
Sequence:CCGGCGAAGAGTAGAAGAATTGGTACTCGAGTACCAATTCTTCTACTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018011.1-364s1c1
Sequence:CCGGGTTCCAAATCTCGGGAAAGTACTCGAGTACTTTCCCGAGATTTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-966s1c1
Sequence:CCGGGAACAAGAACGACAACGTCAACTCGAGTTGACGTTGTCGTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-290s1c1
Sequence:CCGGCAAGAGCAGCAAGCACAACAACTCGAGTTGTTGTGCTTGCTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018011.2-3775s1c1
Sequence:CCGGCCAGGGTATTACTGGACCTATCTCGAGATAGGTCCAGTAATACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018011.1-845s1c1
Sequence:CCGGGCTAGAGCGAATACTGGAAGACTCGAGTCTTCCAGTATTCGCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-732s1c1
Sequence:CCGGGAAGCCAAACGCATCATGGAACTCGAGTTCCATGATGCGTTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-293s1c1
Sequence:CCGGGAGCAGCAAGCACAACAAGAACTCGAGTTCTTGTTGTGCTTGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-975s1c1
Sequence:CCGGCGACAACGTCAACAGAAAGAACTCGAGTTCTTTCTGTTGACGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018011.1-630s1c1
Sequence:CCGGGAAACAGCACGAAGAGTAGAACTCGAGTTCTACTCTTCGTGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018011
VALIDATED
ARGLU1 MISSION shRNA shRNA Plasmid DNA
arginine and glutamate rich 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018011.1-643s1c1
Sequence:CCGGGAGTAGAAGAATTGGTAGCAACTCGAGTTGCTACCAATTCTTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-981s1c1
Sequence:CCGGCGTCAACAGAAAGAAGAACAACTCGAGTTGTTCTTCTTTCTGTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018011.1-937s1c1
Sequence:CCGGGAAAGATTCATGAGGAAAGGACTCGAGTCCTTTCCTCATGAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-948s1c1
Sequence:CCGGGAGGAAAGGATGAAACTAGAACTCGAGTTCTAGTTTCATCCTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018011.1-849s1c1
Sequence:CCGGGAGCGAATACTGGAAGAGAATCTCGAGATTCTCTTCCAGTATTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018011.1-696s1c1
Sequence:CCGGGATGAAATTGAACGAGAAGTTCTCGAGAACTTCTCGTTCAATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018011.1-639s1c1
Sequence:CCGGCGAAGAGTAGAAGAATTGGTACTCGAGTACCAATTCTTCTACTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018011.1-364s1c1
Sequence:CCGGGTTCCAAATCTCGGGAAAGTACTCGAGTACTTTCCCGAGATTTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-966s1c1
Sequence:CCGGGAACAAGAACGACAACGTCAACTCGAGTTGACGTTGTCGTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-290s1c1
Sequence:CCGGCAAGAGCAGCAAGCACAACAACTCGAGTTGTTGTGCTTGCTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018011.2-3775s1c1
Sequence:CCGGCCAGGGTATTACTGGACCTATCTCGAGATAGGTCCAGTAATACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018011.1-845s1c1
Sequence:CCGGGCTAGAGCGAATACTGGAAGACTCGAGTCTTCCAGTATTCGCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-732s1c1
Sequence:CCGGGAAGCCAAACGCATCATGGAACTCGAGTTCCATGATGCGTTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-293s1c1
Sequence:CCGGGAGCAGCAAGCACAACAAGAACTCGAGTTCTTGTTGTGCTTGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-975s1c1
Sequence:CCGGCGACAACGTCAACAGAAAGAACTCGAGTTCTTTCTGTTGACGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018011.1-630s1c1
Sequence:CCGGGAAACAGCACGAAGAGTAGAACTCGAGTTCTACTCTTCGTGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018011
VALIDATED
ARGLU1 MISSION shRNA Lentiviral Transduction Particles
arginine and glutamate rich 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018011.1-643s1c1
Sequence:CCGGGAGTAGAAGAATTGGTAGCAACTCGAGTTGCTACCAATTCTTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-981s1c1
Sequence:CCGGCGTCAACAGAAAGAAGAACAACTCGAGTTGTTCTTCTTTCTGTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018011.1-937s1c1
Sequence:CCGGGAAAGATTCATGAGGAAAGGACTCGAGTCCTTTCCTCATGAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-948s1c1
Sequence:CCGGGAGGAAAGGATGAAACTAGAACTCGAGTTCTAGTTTCATCCTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018011.1-849s1c1
Sequence:CCGGGAGCGAATACTGGAAGAGAATCTCGAGATTCTCTTCCAGTATTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018011.1-696s1c1
Sequence:CCGGGATGAAATTGAACGAGAAGTTCTCGAGAACTTCTCGTTCAATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018011.1-639s1c1
Sequence:CCGGCGAAGAGTAGAAGAATTGGTACTCGAGTACCAATTCTTCTACTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018011.1-364s1c1
Sequence:CCGGGTTCCAAATCTCGGGAAAGTACTCGAGTACTTTCCCGAGATTTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-966s1c1
Sequence:CCGGGAACAAGAACGACAACGTCAACTCGAGTTGACGTTGTCGTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-290s1c1
Sequence:CCGGCAAGAGCAGCAAGCACAACAACTCGAGTTGTTGTGCTTGCTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018011.2-3775s1c1
Sequence:CCGGCCAGGGTATTACTGGACCTATCTCGAGATAGGTCCAGTAATACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018011.1-845s1c1
Sequence:CCGGGCTAGAGCGAATACTGGAAGACTCGAGTCTTCCAGTATTCGCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-732s1c1
Sequence:CCGGGAAGCCAAACGCATCATGGAACTCGAGTTCCATGATGCGTTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-293s1c1
Sequence:CCGGGAGCAGCAAGCACAACAAGAACTCGAGTTCTTGTTGTGCTTGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018011.1-975s1c1
Sequence:CCGGCGACAACGTCAACAGAAAGAACTCGAGTTCTTTCTGTTGACGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018011.1-630s1c1
Sequence:CCGGGAAACAGCACGAAGAGTAGAACTCGAGTTCTACTCTTCGTGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176849
VALIDATED
ARGLU1 MISSION shRNA Bacterial Glycerol Stock
arginine and glutamate rich 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176849.2-800s1c1
Sequence:CCGGGAGATGGAATGCGACTATCTTCTCGAGAAGATAGTCGCATTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176849.2-249s1c1
Sequence:CCGGCAAGAGCTCCAAGCACAACAACTCGAGTTGTTGTGCTTGGAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-613s21c1
Sequence:CCGGAGTGGAAGAATTGGTAGCAAACTCGAGTTTGCTACCAATTCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-680s21c1
Sequence:CCGGGAAGTTCTCCGAAGGGTTGAACTCGAGTTCAACCCTTCGGAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-873s21c1
Sequence:CCGGCTGAAGAACAGTTGAGAATTGCTCGAGCAATTCTCAACTGTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-1367s21c1
Sequence:CCGGGACCACTGACTTCGGAGTTATCTCGAGATAACTCCGAAGTCAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176849.3-886s1c1
Sequence:CCGGGAGAATTGTTGAAGAACAAAGCTCGAGCTTTGTTCTTCAACAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176849.3-1031s1c1
Sequence:CCGGGATTGAATGGCAAACTCTGAACTCGAGTTCAGAGTTTGCCATTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-810s21c1
Sequence:CCGGAGGAACTGGAGCGGATATTAGCTCGAGCTAATATCCGCTCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176849
VALIDATED
ARGLU1 MISSION shRNA shRNA Plasmid DNA
arginine and glutamate rich 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176849.2-800s1c1
Sequence:CCGGGAGATGGAATGCGACTATCTTCTCGAGAAGATAGTCGCATTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176849.2-249s1c1
Sequence:CCGGCAAGAGCTCCAAGCACAACAACTCGAGTTGTTGTGCTTGGAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-613s21c1
Sequence:CCGGAGTGGAAGAATTGGTAGCAAACTCGAGTTTGCTACCAATTCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-680s21c1
Sequence:CCGGGAAGTTCTCCGAAGGGTTGAACTCGAGTTCAACCCTTCGGAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-873s21c1
Sequence:CCGGCTGAAGAACAGTTGAGAATTGCTCGAGCAATTCTCAACTGTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-1367s21c1
Sequence:CCGGGACCACTGACTTCGGAGTTATCTCGAGATAACTCCGAAGTCAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176849.3-886s1c1
Sequence:CCGGGAGAATTGTTGAAGAACAAAGCTCGAGCTTTGTTCTTCAACAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176849.3-1031s1c1
Sequence:CCGGGATTGAATGGCAAACTCTGAACTCGAGTTCAGAGTTTGCCATTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-810s21c1
Sequence:CCGGAGGAACTGGAGCGGATATTAGCTCGAGCTAATATCCGCTCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176849
VALIDATED
ARGLU1 MISSION shRNA Lentiviral Transduction Particles
arginine and glutamate rich 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176849.2-800s1c1
Sequence:CCGGGAGATGGAATGCGACTATCTTCTCGAGAAGATAGTCGCATTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176849.2-249s1c1
Sequence:CCGGCAAGAGCTCCAAGCACAACAACTCGAGTTGTTGTGCTTGGAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-613s21c1
Sequence:CCGGAGTGGAAGAATTGGTAGCAAACTCGAGTTTGCTACCAATTCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-680s21c1
Sequence:CCGGGAAGTTCTCCGAAGGGTTGAACTCGAGTTCAACCCTTCGGAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-873s21c1
Sequence:CCGGCTGAAGAACAGTTGAGAATTGCTCGAGCAATTCTCAACTGTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-1367s21c1
Sequence:CCGGGACCACTGACTTCGGAGTTATCTCGAGATAACTCCGAAGTCAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176849.3-886s1c1
Sequence:CCGGGAGAATTGTTGAAGAACAAAGCTCGAGCTTTGTTCTTCAACAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176849.3-1031s1c1
Sequence:CCGGGATTGAATGGCAAACTCTGAACTCGAGTTCAGAGTTTGCCATTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_176849.3-810s21c1
Sequence:CCGGAGGAACTGGAGCGGATATTAGCTCGAGCTAATATCCGCTCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks