EMAIL THIS PAGE TO A FRIEND

ARHGAP10

Rho GTPase activating protein 10

56 Gene Product Result for
Synonyms: GRAF2 PS-GAP PSGAP
UniProtKB ID: A1A4S6, A1L0S5, Q2VPC4, Q2VPC5, Q96EV3, Q96S75
Gene ID:
Mouse(78514) Rho GTPase activating protein 10
Rat(688429) Rho GTPase activating protein 10
naked mole-rat(101714770) Rho GTPase activating protein 10
domestic guinea pig(100712769) Rho GTPase activating protein 10
sheep(101107633) Rho GTPase activating protein 10
Zebrafish(692277) Rho GTPase activating protein 10
cow(510704) Rho GTPase activating protein 10
Horse(100070647) Rho GTPase activating protein 10
domestic cat(101082397) Rho GTPase activating protein 10
dog(482639) Rho GTPase activating protein 10
chicken(422471) Rho GTPase activating protein 10
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024605 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024605 Rosetta Predictions human pricing
NM_001109501 Rosetta Predictions rat pricing
NM_030113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200016 predicted 2214
2 SASI_Hs02_00356968 predicted 888
3 SASI_Hs01_00200017 predicted 905
4 SASI_Hs02_00356969 predicted 466
5 SASI_Hs01_00200018 predicted 2087
6 SASI_Hs01_00200019 predicted 620
7 SASI_Hs01_00200020 predicted 478
8 SASI_Hs01_00200021 predicted 1286
9 SASI_Hs01_00200023 predicted 697
10 SASI_Hs01_00200025 predicted 968
11 SASI_Hs01_00200022 predicted 248
12 SASI_Hs01_00200024 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249019 predicted 1874
2 SASI_Rn02_00249020 predicted 1294
3 SASI_Rn02_00249021 predicted 602
4 SASI_Rn02_00249022 predicted 1271
5 SASI_Rn02_00249023 predicted 1784
6 SASI_Rn02_00249024 predicted 1612
7 SASI_Rn02_00249025 predicted 2101
8 SASI_Rn02_00249026 predicted 1354
9 SASI_Rn02_00249027 predicted 489
10 SASI_Rn02_00249028 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116790 predicted 1705
2 SASI_Mm02_00336506 predicted 1207
3 SASI_Mm02_00336507 predicted 515
4 SASI_Mm02_00336508 predicted 2450
5 SASI_Mm01_00116795 predicted 847
6 SASI_Mm01_00116797 predicted 1293
7 SASI_Mm01_00116798 predicted 1405
8 SASI_Mm02_00336509 predicted 316
9 SASI_Mm01_00116799 predicted 419
10 SASI_Mm02_00336510 predicted 817
11 SASI_Mm01_00116791 predicted 1504
12 SASI_Mm01_00116792 predicted 485
13 SASI_Mm01_00116793 predicted 1423
14 SASI_Mm01_00116794 predicted 282
15 SASI_Mm01_00116796 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030113
VALIDATED
ARHGAP10 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-687s1c1
Sequence:CCGGGCTGTCCTTCTTTCAGGGAATCTCGAGATTCCCTGAAAGAAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-1557s1c1
Sequence:CCGGCCGAGTTAATGCCATCCACTTCTCGAGAAGTGGATGGCATTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-1921s1c1
Sequence:CCGGGCCGTGTACAACCTTTGTCTTCTCGAGAAGACAAAGGTTGTACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-1741s1c1
Sequence:CCGGGCCATCATGGATTTGAAGTTTCTCGAGAAACTTCAAATCCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-654s1c1
Sequence:CCGGAGAAAGAAAGAAGTTCGAGTTCTCGAGAACTCGAACTTCTTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030113.2-1594s21c1
Sequence:CCGGCCGAGTTAATGCCATCCACTTCTCGAGAAGTGGATGGCATTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030113.2-1958s21c1
Sequence:CCGGGCCGTGTACAACCTTTGTCTTCTCGAGAAGACAAAGGTTGTACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030113.2-1778s21c1
Sequence:CCGGGCCATCATGGATTTGAAGTTTCTCGAGAAACTTCAAATCCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030113.2-691s21c1
Sequence:CCGGAGAAAGAAAGAAGTTCGAGTTCTCGAGAACTCGAACTTCTTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030113
VALIDATED
ARHGAP10 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-687s1c1
Sequence:CCGGGCTGTCCTTCTTTCAGGGAATCTCGAGATTCCCTGAAAGAAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-1557s1c1
Sequence:CCGGCCGAGTTAATGCCATCCACTTCTCGAGAAGTGGATGGCATTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-1921s1c1
Sequence:CCGGGCCGTGTACAACCTTTGTCTTCTCGAGAAGACAAAGGTTGTACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-1741s1c1
Sequence:CCGGGCCATCATGGATTTGAAGTTTCTCGAGAAACTTCAAATCCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-654s1c1
Sequence:CCGGAGAAAGAAAGAAGTTCGAGTTCTCGAGAACTCGAACTTCTTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030113.2-1594s21c1
Sequence:CCGGCCGAGTTAATGCCATCCACTTCTCGAGAAGTGGATGGCATTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030113.2-1958s21c1
Sequence:CCGGGCCGTGTACAACCTTTGTCTTCTCGAGAAGACAAAGGTTGTACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030113.2-1778s21c1
Sequence:CCGGGCCATCATGGATTTGAAGTTTCTCGAGAAACTTCAAATCCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030113.2-691s21c1
Sequence:CCGGAGAAAGAAAGAAGTTCGAGTTCTCGAGAACTCGAACTTCTTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030113
VALIDATED
ARHGAP10 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-687s1c1
Sequence:CCGGGCTGTCCTTCTTTCAGGGAATCTCGAGATTCCCTGAAAGAAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-1557s1c1
Sequence:CCGGCCGAGTTAATGCCATCCACTTCTCGAGAAGTGGATGGCATTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-1921s1c1
Sequence:CCGGGCCGTGTACAACCTTTGTCTTCTCGAGAAGACAAAGGTTGTACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-1741s1c1
Sequence:CCGGGCCATCATGGATTTGAAGTTTCTCGAGAAACTTCAAATCCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030113.1-654s1c1
Sequence:CCGGAGAAAGAAAGAAGTTCGAGTTCTCGAGAACTCGAACTTCTTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030113.2-1594s21c1
Sequence:CCGGCCGAGTTAATGCCATCCACTTCTCGAGAAGTGGATGGCATTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030113.2-1958s21c1
Sequence:CCGGGCCGTGTACAACCTTTGTCTTCTCGAGAAGACAAAGGTTGTACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030113.2-1778s21c1
Sequence:CCGGGCCATCATGGATTTGAAGTTTCTCGAGAAACTTCAAATCCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030113.2-691s21c1
Sequence:CCGGAGAAAGAAAGAAGTTCGAGTTCTCGAGAACTCGAACTTCTTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024605
VALIDATED
ARHGAP10 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024605.2-729s1c1
Sequence:CCGGGCCCTCATGGACTTGAAGTTTCTCGAGAAACTTCAAGTCCATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024605.2-544s1c1
Sequence:CCGGCTCGTGTTAATGCGATCCATTCTCGAGAATGGATCGCATTAACACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024605.2-1406s1c1
Sequence:CCGGGATTCCACAGAACTACGTCAACTCGAGTTGACGTAGTTCTGTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024605.2-581s1c1
Sequence:CCGGGCCAGAGAAGAATAAAGAGATCTCGAGATCTCTTTATTCTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024605.2-479s1c1
Sequence:CCGGGCCTCTCATGACCTATGAGTTCTCGAGAACTCATAGGTCATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024605.3-1290s21c1
Sequence:CCGGGAGTATGTTGATGGATGTAAACTCGAGTTTACATCCATCAACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024605.3-1213s21c1
Sequence:CCGGGCCGTTGAAACACGAGGTATACTCGAGTATACCTCGTGTTTCAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024605.3-250s21c1
Sequence:CCGGGATGCTTCCTTACGTGAATTTCTCGAGAAATTCACGTAAGGAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024605.3-2222s21c1
Sequence:CCGGCAGAACACAGCTCGGAATTATCTCGAGATAATTCCGAGCTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024605
VALIDATED
ARHGAP10 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024605.2-729s1c1
Sequence:CCGGGCCCTCATGGACTTGAAGTTTCTCGAGAAACTTCAAGTCCATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024605.2-544s1c1
Sequence:CCGGCTCGTGTTAATGCGATCCATTCTCGAGAATGGATCGCATTAACACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024605.2-1406s1c1
Sequence:CCGGGATTCCACAGAACTACGTCAACTCGAGTTGACGTAGTTCTGTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024605.2-581s1c1
Sequence:CCGGGCCAGAGAAGAATAAAGAGATCTCGAGATCTCTTTATTCTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024605.2-479s1c1
Sequence:CCGGGCCTCTCATGACCTATGAGTTCTCGAGAACTCATAGGTCATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024605.3-1290s21c1
Sequence:CCGGGAGTATGTTGATGGATGTAAACTCGAGTTTACATCCATCAACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024605.3-1213s21c1
Sequence:CCGGGCCGTTGAAACACGAGGTATACTCGAGTATACCTCGTGTTTCAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024605.3-250s21c1
Sequence:CCGGGATGCTTCCTTACGTGAATTTCTCGAGAAATTCACGTAAGGAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024605.3-2222s21c1
Sequence:CCGGCAGAACACAGCTCGGAATTATCTCGAGATAATTCCGAGCTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024605
VALIDATED
ARHGAP10 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024605.2-729s1c1
Sequence:CCGGGCCCTCATGGACTTGAAGTTTCTCGAGAAACTTCAAGTCCATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024605.2-544s1c1
Sequence:CCGGCTCGTGTTAATGCGATCCATTCTCGAGAATGGATCGCATTAACACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024605.2-1406s1c1
Sequence:CCGGGATTCCACAGAACTACGTCAACTCGAGTTGACGTAGTTCTGTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024605.2-581s1c1
Sequence:CCGGGCCAGAGAAGAATAAAGAGATCTCGAGATCTCTTTATTCTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024605.2-479s1c1
Sequence:CCGGGCCTCTCATGACCTATGAGTTCTCGAGAACTCATAGGTCATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024605.3-1290s21c1
Sequence:CCGGGAGTATGTTGATGGATGTAAACTCGAGTTTACATCCATCAACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024605.3-1213s21c1
Sequence:CCGGGCCGTTGAAACACGAGGTATACTCGAGTATACCTCGTGTTTCAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024605.3-250s21c1
Sequence:CCGGGATGCTTCCTTACGTGAATTTCTCGAGAAATTCACGTAAGGAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024605.3-2222s21c1
Sequence:CCGGCAGAACACAGCTCGGAATTATCTCGAGATAATTCCGAGCTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks