EMAIL THIS PAGE TO A FRIEND

ARHGAP11A

Rho GTPase activating protein 11A

79 Gene Product Result for
UniProtKB ID: Q6P4F7, Q6PI96, Q9Y3S6
Gene ID:
Mouse(228482) Rho GTPase activating protein 11A
Rat(296060) Rho GTPase activating protein 11A
Zebrafish(406608) Rho GTPase activating protein 11A
cow(617811) Rho GTPase activating protein 11A
Horse(100071763) Rho GTPase activating protein 11A
domestic cat(101096238) Rho GTPase activating protein 11A
dog(487476) Rho GTPase activating protein 11A
chicken(423289) Rho GTPase activating protein 11A
sheep(101103069) Rho GTPase activating protein 11A
Domestic Rabbit(100341552) Rho GTPase activating protein 11A
domestic guinea pig(100731402) Rho GTPase activating protein 11A
naked mole-rat(101722500) Rho GTPase activating protein 11A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199357 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014783 Rosetta Predictions human pricing
NM_199357 Rosetta Predictions human pricing
XM_001074602 Rosetta Predictions rat pricing
XM_230459 Rosetta Predictions rat pricing
NM_181416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240606 predicted 1618
2 SASI_Hs01_00240607 predicted 1815
3 SASI_Hs01_00240608 predicted 1261
4 SASI_Hs01_00240609 predicted 1220
5 SASI_Hs01_00240610 predicted 1780
6 SASI_Hs01_00240611 predicted 763
7 SASI_Hs02_00346283 predicted 1058
8 SASI_Hs01_00240612 predicted 1860
9 SASI_Hs01_00240614 predicted 989
10 SASI_Hs01_00240615 predicted 1569
11 SASI_Hs01_00240613 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223783 predicted 1618
2 SASI_Hs01_00223784 predicted 1815
3 SASI_Hs01_00223785 predicted 1265
4 SASI_Hs01_00223787 predicted 1778
5 SASI_Hs01_00223788 predicted 767
6 SASI_Hs02_00372798 predicted 1660
7 SASI_Hs02_00372799 predicted 1057
8 SASI_Hs01_00223789 predicted 1860
9 SASI_Hs01_00223791 predicted 988
10 SASI_Hs01_00223792 predicted 1567
11 SASI_Hs01_00223786 predicted 1228
12 SASI_Hs01_00223790 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346767 predicted 3066
2 SASI_Rn02_00346768 predicted 1815
3 SASI_Rn02_00346769 predicted 3030
4 SASI_Rn02_00346770 predicted 1122
5 SASI_Rn02_00346771 predicted 3219
6 SASI_Rn02_00346772 predicted 362
7 SASI_Rn02_00346773 predicted 835
8 SASI_Rn02_00346774 predicted 791
9 SASI_Rn02_00346775 predicted 1551
10 SASI_Rn02_00346776 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386220 predicted 3065
2 SASI_Rn02_00386221 predicted 1812
3 SASI_Rn02_00386222 predicted 3027
4 SASI_Rn02_00386223 predicted 1121
5 SASI_Rn02_00386224 predicted 3219
6 SASI_Rn02_00386225 predicted 368
7 SASI_Rn02_00386226 predicted 836
8 SASI_Rn02_00386227 predicted 796
9 SASI_Rn02_00386228 predicted 1550
10 SASI_Rn02_00386229 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178615 predicted 1598
2 SASI_Mm01_00178616 predicted 2123
3 SASI_Mm01_00178617 predicted 1150
4 SASI_Mm01_00178618 predicted 3352
5 SASI_Mm01_00178619 predicted 1148
6 SASI_Mm01_00178620 predicted 861
7 SASI_Mm01_00178621 predicted 1464
8 SASI_Mm01_00178622 predicted 1753
9 SASI_Mm01_00178623 predicted 2060
10 SASI_Mm01_00178624 predicted 1658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199357
VALIDATED
ARHGAP11A MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 11A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-1692s21c1
Sequence:CCGGCCAAATGCTAAGCGTACATTGCTCGAGCAATGTACGCTTAGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-1433s21c1
Sequence:CCGGTATTGGGCGTGTACCAGATTTCTCGAGAAATCTGGTACACGCCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-1403s21c1
Sequence:CCGGAGTACAGACTCTTATCGATTACTCGAGTAATCGATAAGAGTCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-2017s21c1
Sequence:CCGGGAAGATCTCTGCGTTTGAAATCTCGAGATTTCAAACGCAGAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-1776s21c1
Sequence:CCGGTTTGAGCTGTTGCCAAGTAATCTCGAGATTACTTGGCAACAGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199357.1-1470s1c1
Sequence:CCGGCCAGCCATGTTGGGTATTGATCTCGAGATCAATACCCAACATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_199357.1-1664s1c1
Sequence:CCGGGCTATCTGAATCACCAGTGATCTCGAGATCACTGGTGATTCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_199357.1-1629s1c1
Sequence:CCGGCCTTCTATTACACCTCAAGAACTCGAGTTCTTGAGGTGTAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_199357.1-1819s1c1
Sequence:CCGGCGGTATCAGTTCACATCGATACTCGAGTATCGATGTGAACTGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199357
VALIDATED
ARHGAP11A MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 11A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-1692s21c1
Sequence:CCGGCCAAATGCTAAGCGTACATTGCTCGAGCAATGTACGCTTAGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-1433s21c1
Sequence:CCGGTATTGGGCGTGTACCAGATTTCTCGAGAAATCTGGTACACGCCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-1403s21c1
Sequence:CCGGAGTACAGACTCTTATCGATTACTCGAGTAATCGATAAGAGTCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-2017s21c1
Sequence:CCGGGAAGATCTCTGCGTTTGAAATCTCGAGATTTCAAACGCAGAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-1776s21c1
Sequence:CCGGTTTGAGCTGTTGCCAAGTAATCTCGAGATTACTTGGCAACAGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199357.1-1470s1c1
Sequence:CCGGCCAGCCATGTTGGGTATTGATCTCGAGATCAATACCCAACATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_199357.1-1664s1c1
Sequence:CCGGGCTATCTGAATCACCAGTGATCTCGAGATCACTGGTGATTCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_199357.1-1629s1c1
Sequence:CCGGCCTTCTATTACACCTCAAGAACTCGAGTTCTTGAGGTGTAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_199357.1-1819s1c1
Sequence:CCGGCGGTATCAGTTCACATCGATACTCGAGTATCGATGTGAACTGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199357
VALIDATED
ARHGAP11A MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 11A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-1692s21c1
Sequence:CCGGCCAAATGCTAAGCGTACATTGCTCGAGCAATGTACGCTTAGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-1433s21c1
Sequence:CCGGTATTGGGCGTGTACCAGATTTCTCGAGAAATCTGGTACACGCCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-1403s21c1
Sequence:CCGGAGTACAGACTCTTATCGATTACTCGAGTAATCGATAAGAGTCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-2017s21c1
Sequence:CCGGGAAGATCTCTGCGTTTGAAATCTCGAGATTTCAAACGCAGAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199357.1-1776s21c1
Sequence:CCGGTTTGAGCTGTTGCCAAGTAATCTCGAGATTACTTGGCAACAGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199357.1-1470s1c1
Sequence:CCGGCCAGCCATGTTGGGTATTGATCTCGAGATCAATACCCAACATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_199357.1-1664s1c1
Sequence:CCGGGCTATCTGAATCACCAGTGATCTCGAGATCACTGGTGATTCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_199357.1-1629s1c1
Sequence:CCGGCCTTCTATTACACCTCAAGAACTCGAGTTCTTGAGGTGTAATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_199357.1-1819s1c1
Sequence:CCGGCGGTATCAGTTCACATCGATACTCGAGTATCGATGTGAACTGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181416
VALIDATED
ARHGAP11A MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 11A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181416.2-3299s1c1
Sequence:CCGGCCTTTGGATGATCTCACGAATCTCGAGATTCGTGAGATCATCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181416.2-1788s1c1
Sequence:CCGGCCAAAGTCAGTCGTAAAGAAACTCGAGTTTCTTTACGACTGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181416.2-3507s1c1
Sequence:CCGGGCTCGTCATCAGTGTAAATAACTCGAGTTATTTACACTGATGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181416.2-1101s1c1
Sequence:CCGGGCAGCAATCTTGCAGTAATATCTCGAGATATTACTGCAAGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181416
VALIDATED
ARHGAP11A MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 11A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181416.2-3299s1c1
Sequence:CCGGCCTTTGGATGATCTCACGAATCTCGAGATTCGTGAGATCATCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181416.2-1788s1c1
Sequence:CCGGCCAAAGTCAGTCGTAAAGAAACTCGAGTTTCTTTACGACTGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181416.2-3507s1c1
Sequence:CCGGGCTCGTCATCAGTGTAAATAACTCGAGTTATTTACACTGATGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181416.2-1101s1c1
Sequence:CCGGGCAGCAATCTTGCAGTAATATCTCGAGATATTACTGCAAGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181416
VALIDATED
ARHGAP11A MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 11A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181416.2-3299s1c1
Sequence:CCGGCCTTTGGATGATCTCACGAATCTCGAGATTCGTGAGATCATCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181416.2-1788s1c1
Sequence:CCGGCCAAAGTCAGTCGTAAAGAAACTCGAGTTTCTTTACGACTGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181416.2-3507s1c1
Sequence:CCGGGCTCGTCATCAGTGTAAATAACTCGAGTTATTTACACTGATGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181416.2-1101s1c1
Sequence:CCGGGCAGCAATCTTGCAGTAATATCTCGAGATATTACTGCAAGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks