EMAIL THIS PAGE TO A FRIEND

ARHGAP11B

Rho GTPase activating protein 11B

24 Gene Product Result for
Synonyms: B'-T FAM7B1
Species: Human ARHGAP11B(89839)
UniProtKB ID: Q3KRB8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039841 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148971 MISSION® esiRNA esiRNA human ARHGAP11B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039841 Rosetta Predictions human pricing
XM_001716910 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156070 predicted 711
2 SASI_Hs01_00156072 predicted 636
3 SASI_Hs01_00156073 predicted 638
4 SASI_Hs01_00156074 predicted 730
5 SASI_Hs01_00156075 predicted 479
6 SASI_Hs01_00156076 predicted 689
7 SASI_Hs01_00156077 predicted 404
8 SASI_Hs01_00156078 predicted 326
9 SASI_Hs01_00156079 predicted 226
10 SASI_Hs02_00308683 predicted 406
11 SASI_Hs01_00156071 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00413776 predicted 407
2 SASI_Hs02_00413777 predicted 391
3 SASI_Hs02_00413778 predicted 399
4 SASI_Hs02_00413779 predicted 524
5 SASI_Hs02_00413780 predicted 561
6 SASI_Hs02_00413781 predicted 381
7 SASI_Hs02_00413782 predicted 411
8 SASI_Hs02_00413783 predicted 520
9 SASI_Hs02_00413784 predicted 488
10 SASI_Hs02_00413785 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039841
ARHGAP11B MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 11B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-836s21c1
Sequence:CCGGTACCAGCCATGTTGGGTATTGCTCGAGCAATACCCAACATGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-353s21c1
Sequence:CCGGGTCGATGCTTGCACATCTTTACTCGAGTAAAGATGTGCAAGCATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-722s21c1
Sequence:CCGGAGCAATCTTGCAGTAATATTTCTCGAGAAATATTACTGCAAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-191s21c1
Sequence:CCGGCGGGCCTTCTATGGTATTAAGCTCGAGCTTAATACCATAGAAGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-251s21c1
Sequence:CCGGGAAACAGCAGCCACGGAAATACTCGAGTATTTCCGTGGCTGCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039841
ARHGAP11B MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 11B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-836s21c1
Sequence:CCGGTACCAGCCATGTTGGGTATTGCTCGAGCAATACCCAACATGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-353s21c1
Sequence:CCGGGTCGATGCTTGCACATCTTTACTCGAGTAAAGATGTGCAAGCATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-722s21c1
Sequence:CCGGAGCAATCTTGCAGTAATATTTCTCGAGAAATATTACTGCAAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-191s21c1
Sequence:CCGGCGGGCCTTCTATGGTATTAAGCTCGAGCTTAATACCATAGAAGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-251s21c1
Sequence:CCGGGAAACAGCAGCCACGGAAATACTCGAGTATTTCCGTGGCTGCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039841
ARHGAP11B MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 11B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-836s21c1
Sequence:CCGGTACCAGCCATGTTGGGTATTGCTCGAGCAATACCCAACATGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-353s21c1
Sequence:CCGGGTCGATGCTTGCACATCTTTACTCGAGTAAAGATGTGCAAGCATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-722s21c1
Sequence:CCGGAGCAATCTTGCAGTAATATTTCTCGAGAAATATTACTGCAAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-191s21c1
Sequence:CCGGCGGGCCTTCTATGGTATTAAGCTCGAGCTTAATACCATAGAAGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039841.1-251s21c1
Sequence:CCGGGAAACAGCAGCCACGGAAATACTCGAGTATTTCCGTGGCTGCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks