EMAIL THIS PAGE TO A FRIEND

ARHGAP12

Rho GTPase activating protein 12

186 Gene Product Result for
Gene ID:
Human(94134) Summary: This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may be involved in suppressing tumor formation by regulating cell invasion and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(75415) Rho GTPase activating protein 12
Rat(307016) Rho GTPase activating protein 12
chicken(420473) Rho GTPase activating protein 12
Horse(100055065) Rho GTPase activating protein 12
cow(540393) Rho GTPase activating protein 12
domestic cat(101091791) Rho GTPase activating protein 12
dog(487088) Rho GTPase activating protein 12
naked mole-rat(101716449) Rho GTPase activating protein 12
domestic guinea pig(100724189) Rho GTPase activating protein 12
sheep(101114797) Rho GTPase activating protein 12
Domestic Rabbit(100354626) Rho GTPase activating protein 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018287 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018287 Rosetta Predictions human pricing
NM_001107357 Rosetta Predictions rat pricing
NM_001039692 Rosetta Predictions mouse pricing
NM_029277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074873 predicted 1944
2 SASI_Hs02_00351668 predicted 1973
3 SASI_Hs02_00351669 predicted 984
4 SASI_Hs01_00074874 predicted 1919
5 SASI_Hs01_00074875 predicted 1363
6 SASI_Hs02_00351670 predicted 1497
7 SASI_Hs01_00074876 predicted 1374
8 SASI_Hs02_00351671 predicted 2224
9 SASI_Hs01_00074877 predicted 495
10 SASI_Hs01_00074878 predicted 1523
11 SASI_Hs01_00074871 predicted 821
12 SASI_Hs01_00074872 predicted 2604
13 SASI_Hs01_00074879 predicted 529
14 SASI_Hs01_00074880 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228025 predicted 2277
2 SASI_Rn02_00228026 predicted 1869
3 SASI_Rn02_00228027 predicted 1882
4 SASI_Rn02_00228028 predicted 1812
5 SASI_Rn02_00228029 predicted 2624
6 SASI_Rn02_00228030 predicted 2338
7 SASI_Rn02_00228031 predicted 2176
8 SASI_Rn02_00228032 predicted 2736
9 SASI_Rn02_00228033 predicted 2188
10 SASI_Rn02_00228034 predicted 1921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290220 predicted 1131
2 SASI_Mm01_00098661 predicted 2883
3 SASI_Mm01_00098662 predicted 799
4 SASI_Mm01_00098663 predicted 2783
5 SASI_Mm01_00098664 predicted 871
6 SASI_Mm01_00098665 predicted 2326
7 SASI_Mm01_00098666 predicted 2063
8 SASI_Mm01_00098667 predicted 1120
9 SASI_Mm01_00098669 predicted 2087
10 SASI_Mm02_00290221 predicted 683
11 SASI_Mm01_00098660 predicted 2714
12 SASI_Mm01_00098668 predicted 2895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335053 predicted 1125
2 SASI_Mm01_00199608 predicted 2809
3 SASI_Mm01_00199609 predicted 800
4 SASI_Mm01_00199610 predicted 2707
5 SASI_Mm01_00199611 predicted 873
6 SASI_Mm01_00199612 predicted 2254
7 SASI_Mm01_00199613 predicted 1990
8 SASI_Mm01_00199614 predicted 1116
9 SASI_Mm01_00199616 predicted 2013
10 SASI_Mm02_00335054 predicted 685
11 SASI_Mm01_00199607 predicted 2647
12 SASI_Mm01_00199615 predicted 2825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029277
VALIDATED
ARHGAP12 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029277.2-3111s21c1
Sequence:CCGGAGTCATATACACTGGATAATTCTCGAGAATTATCCAGTGTATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029277.2-2739s21c1
Sequence:CCGGCCACCCTTCTAAAGCCAGAAACTCGAGTTTCTGGCTTTAGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029277.2-2237s21c1
Sequence:CCGGGTTCGTGAGAAAGGTTATATCCTCGAGGATATAACCTTTCTCACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029277.2-3303s21c1
Sequence:CCGGGAAACCTGTGTACTGCATATTCTCGAGAATATGCAGTACACAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029277.2-1238s21c1
Sequence:CCGGGGCCGTTGTTACTACTATAACCTCGAGGTTATAGTAGTAACAACGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029277.1-2555s1c1
Sequence:CCGGCCACCCTTCTAAAGCCAGAAACTCGAGTTTCTGGCTTTAGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029277.1-1282s1c1
Sequence:CCGGCCAGTGACTATACTAAGGAAACTCGAGTTTCCTTAGTATAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029277.1-261s1c1
Sequence:CCGGGCGTATATTGAGGTGGAGTATCTCGAGATACTCCACCTCAATATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029277.1-671s1c1
Sequence:CCGGCCTGACCCATAATAATGGAAACTCGAGTTTCCATTATTATGGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029277
VALIDATED
ARHGAP12 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029277.2-3111s21c1
Sequence:CCGGAGTCATATACACTGGATAATTCTCGAGAATTATCCAGTGTATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029277.2-2739s21c1
Sequence:CCGGCCACCCTTCTAAAGCCAGAAACTCGAGTTTCTGGCTTTAGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029277.2-2237s21c1
Sequence:CCGGGTTCGTGAGAAAGGTTATATCCTCGAGGATATAACCTTTCTCACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029277.2-3303s21c1
Sequence:CCGGGAAACCTGTGTACTGCATATTCTCGAGAATATGCAGTACACAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029277.2-1238s21c1
Sequence:CCGGGGCCGTTGTTACTACTATAACCTCGAGGTTATAGTAGTAACAACGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029277.1-2555s1c1
Sequence:CCGGCCACCCTTCTAAAGCCAGAAACTCGAGTTTCTGGCTTTAGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029277.1-1282s1c1
Sequence:CCGGCCAGTGACTATACTAAGGAAACTCGAGTTTCCTTAGTATAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029277.1-261s1c1
Sequence:CCGGGCGTATATTGAGGTGGAGTATCTCGAGATACTCCACCTCAATATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029277.1-671s1c1
Sequence:CCGGCCTGACCCATAATAATGGAAACTCGAGTTTCCATTATTATGGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029277
VALIDATED
ARHGAP12 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029277.2-3111s21c1
Sequence:CCGGAGTCATATACACTGGATAATTCTCGAGAATTATCCAGTGTATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029277.2-2739s21c1
Sequence:CCGGCCACCCTTCTAAAGCCAGAAACTCGAGTTTCTGGCTTTAGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029277.2-2237s21c1
Sequence:CCGGGTTCGTGAGAAAGGTTATATCCTCGAGGATATAACCTTTCTCACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029277.2-3303s21c1
Sequence:CCGGGAAACCTGTGTACTGCATATTCTCGAGAATATGCAGTACACAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029277.2-1238s21c1
Sequence:CCGGGGCCGTTGTTACTACTATAACCTCGAGGTTATAGTAGTAACAACGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029277.1-2555s1c1
Sequence:CCGGCCACCCTTCTAAAGCCAGAAACTCGAGTTTCTGGCTTTAGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029277.1-1282s1c1
Sequence:CCGGCCAGTGACTATACTAAGGAAACTCGAGTTTCCTTAGTATAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029277.1-261s1c1
Sequence:CCGGGCGTATATTGAGGTGGAGTATCTCGAGATACTCCACCTCAATATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029277.1-671s1c1
Sequence:CCGGCCTGACCCATAATAATGGAAACTCGAGTTTCCATTATTATGGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018287
VALIDATED
ARHGAP12 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_018287.5-2556s21c1
Sequence:CCGGCGCTGCTGTTAAGGACCTAATCTCGAGATTAGGTCCTTAACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018287.5-723s21c1
Sequence:CCGGCCTGACCCATAATAACGGAAACTCGAGTTTCCGTTATTATGGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018287.5-1538s21c1
Sequence:CCGGGCACCATTGTATTGGACACTACTCGAGTAGTGTCCAATACAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018287.5-3096s21c1
Sequence:CCGGCCAGTCATATACACTGGATAACTCGAGTTATCCAGTGTATATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018287.4-3097s1c1
Sequence:CCGGCCAGTCATATACACTGGATAACTCGAGTTATCCAGTGTATATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018287.4-1539s1c1
Sequence:CCGGGCACCATTGTATTGGACACTACTCGAGTAGTGTCCAATACAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018287.4-724s1c1
Sequence:CCGGCCTGACCCATAATAACGGAAACTCGAGTTTCCGTTATTATGGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018287.4-852s1c1
Sequence:CCGGCCCAGGAACAATCTTGTGATTCTCGAGAATCACAAGATTGTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018287.4-2557s1c1
Sequence:CCGGCGCTGCTGTTAAGGACCTAATCTCGAGATTAGGTCCTTAACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018287
VALIDATED
ARHGAP12 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_018287.5-2556s21c1
Sequence:CCGGCGCTGCTGTTAAGGACCTAATCTCGAGATTAGGTCCTTAACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018287.5-723s21c1
Sequence:CCGGCCTGACCCATAATAACGGAAACTCGAGTTTCCGTTATTATGGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018287.5-1538s21c1
Sequence:CCGGGCACCATTGTATTGGACACTACTCGAGTAGTGTCCAATACAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018287.5-3096s21c1
Sequence:CCGGCCAGTCATATACACTGGATAACTCGAGTTATCCAGTGTATATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018287.4-3097s1c1
Sequence:CCGGCCAGTCATATACACTGGATAACTCGAGTTATCCAGTGTATATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018287.4-1539s1c1
Sequence:CCGGGCACCATTGTATTGGACACTACTCGAGTAGTGTCCAATACAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018287.4-724s1c1
Sequence:CCGGCCTGACCCATAATAACGGAAACTCGAGTTTCCGTTATTATGGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018287.4-852s1c1
Sequence:CCGGCCCAGGAACAATCTTGTGATTCTCGAGAATCACAAGATTGTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018287.4-2557s1c1
Sequence:CCGGCGCTGCTGTTAAGGACCTAATCTCGAGATTAGGTCCTTAACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018287
VALIDATED
ARHGAP12 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_018287.5-2556s21c1
Sequence:CCGGCGCTGCTGTTAAGGACCTAATCTCGAGATTAGGTCCTTAACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018287.5-723s21c1
Sequence:CCGGCCTGACCCATAATAACGGAAACTCGAGTTTCCGTTATTATGGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018287.5-1538s21c1
Sequence:CCGGGCACCATTGTATTGGACACTACTCGAGTAGTGTCCAATACAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018287.5-3096s21c1
Sequence:CCGGCCAGTCATATACACTGGATAACTCGAGTTATCCAGTGTATATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018287.4-3097s1c1
Sequence:CCGGCCAGTCATATACACTGGATAACTCGAGTTATCCAGTGTATATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018287.4-1539s1c1
Sequence:CCGGGCACCATTGTATTGGACACTACTCGAGTAGTGTCCAATACAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018287.4-724s1c1
Sequence:CCGGCCTGACCCATAATAACGGAAACTCGAGTTTCCGTTATTATGGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018287.4-852s1c1
Sequence:CCGGCCCAGGAACAATCTTGTGATTCTCGAGAATCACAAGATTGTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018287.4-2557s1c1
Sequence:CCGGCGCTGCTGTTAAGGACCTAATCTCGAGATTAGGTCCTTAACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks