EMAIL THIS PAGE TO A FRIEND

ARHGAP15

Rho GTPase activating protein 15

70 Gene Product Result for
Synonyms: BM046
Gene ID:
Human(55843) Summary: RHO GTPases (see ARHA; MIM 165390) regulate diverse biologic processes, and their activity is regulated by RHO GTPase-activating proteins (GAPs), such as ARHGAP15 (Seoh et al., 2003 [PubMed 12650940]
Mouse(76117) Rho GTPase activating protein 15
Rat(295635) Rho GTPase activating protein 15
Zebrafish(100003547) Rho GTPase activating protein 15
chicken(424303) Rho GTPase activating protein 15
dog(476138) Rho GTPase activating protein 15
domestic cat(101096334) Rho GTPase activating protein 15
Horse(100051192) Rho GTPase activating protein 15
cow(616246) Rho GTPase activating protein 15
sheep(101123443) Rho GTPase activating protein 15
Domestic Rabbit(100353343) Rho GTPase activating protein 15
domestic guinea pig(100728755) Rho GTPase activating protein 15
naked mole-rat(101707990) Rho GTPase activating protein 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018460 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153820 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153820 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153820 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033281 MISSION® esiRNA esiRNA human ARHGAP15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018460 Rosetta Predictions human pricing
NM_001013917 Rosetta Predictions rat pricing
NM_001025377 Rosetta Predictions mouse pricing
NM_153820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181603 predicted 465
2 SASI_Hs01_00181604 predicted 1246
3 SASI_Hs01_00181605 predicted 1367
4 SASI_Hs02_00352014 predicted 247
5 SASI_Hs01_00181607 predicted 1196
6 SASI_Hs02_00352015 predicted 1078
7 SASI_Hs02_00352016 predicted 598
8 SASI_Hs01_00181608 predicted 453
9 SASI_Hs01_00181609 predicted 660
10 SASI_Hs01_00181610 predicted 700
11 SASI_Hs01_00181602 predicted 1022
12 SASI_Hs01_00181606 predicted 664
13 SASI_Hs01_00181611 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013917 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070430 predicted 619
2 SASI_Rn01_00070431 predicted 1024
3 SASI_Rn01_00070432 predicted 1252
4 SASI_Rn01_00070433 predicted 1176
5 SASI_Rn01_00070434 predicted 702
6 SASI_Rn01_00070435 predicted 215
7 SASI_Rn01_00070437 predicted 484
8 SASI_Rn02_00201204 predicted 1164
9 SASI_Rn02_00201205 predicted 549
10 SASI_Rn01_00070439 predicted 364
11 SASI_Rn01_00070436 predicted 1022
12 SASI_Rn01_00070438 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028194 predicted 301
2 SASI_Mm01_00028195 predicted 245
3 SASI_Mm01_00028196 predicted 204
4 SASI_Mm01_00028197 predicted 290
5 SASI_Mm01_00028198 predicted 303
6 SASI_Mm01_00028199 predicted 304
7 SASI_Mm01_00028200 predicted 270
8 SASI_Mm02_00287851 predicted 266
9 SASI_Mm01_00028201 predicted 223
10 SASI_Mm01_00028203 predicted 217
11 SASI_Mm01_00028202 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196349 predicted 306
2 SASI_Mm01_00196350 predicted 246
3 SASI_Mm01_00196351 predicted 212
4 SASI_Mm01_00196352 predicted 296
5 SASI_Mm01_00196353 predicted 305
6 SASI_Mm01_00196354 predicted 310
7 SASI_Mm01_00196355 predicted 273
8 SASI_Mm02_00343547 predicted 267
9 SASI_Mm01_00196356 predicted 222
10 SASI_Mm01_00196358 predicted 223
11 SASI_Mm01_00196357 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018460
ARHGAP15 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 15
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-118s1c1
Sequence:CCGGCCGTGGAAACACTGAATTCTACTCGAGTAGAATTCAGTGTTTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-1299s1c1
Sequence:CCGGGACACCATGAAAGTCCTCTTTCTCGAGAAAGAGGACTTTCATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-718s1c1
Sequence:CCGGCCTCTAGCACTGAATTGCTAACTCGAGTTAGCAATTCAGTGCTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-200s1c1
Sequence:CCGGGCTCAGCCAAAGTAAATCCATCTCGAGATGGATTTACTTTGGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-1232s1c1
Sequence:CCGGGCAAGACAACAACACAAGAATCTCGAGATTCTTGTGTTGTTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018460.3-300s21c1
Sequence:CCGGGGAAGGTCACTGAACCTATATCTCGAGATATAGGTTCAGTGACCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018460.3-665s21c1
Sequence:CCGGGATATTGACTTCATCATATTGCTCGAGCAATATGATGAAGTCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018460
ARHGAP15 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 15
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-118s1c1
Sequence:CCGGCCGTGGAAACACTGAATTCTACTCGAGTAGAATTCAGTGTTTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-1299s1c1
Sequence:CCGGGACACCATGAAAGTCCTCTTTCTCGAGAAAGAGGACTTTCATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-718s1c1
Sequence:CCGGCCTCTAGCACTGAATTGCTAACTCGAGTTAGCAATTCAGTGCTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-200s1c1
Sequence:CCGGGCTCAGCCAAAGTAAATCCATCTCGAGATGGATTTACTTTGGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-1232s1c1
Sequence:CCGGGCAAGACAACAACACAAGAATCTCGAGATTCTTGTGTTGTTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018460.3-300s21c1
Sequence:CCGGGGAAGGTCACTGAACCTATATCTCGAGATATAGGTTCAGTGACCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018460.3-665s21c1
Sequence:CCGGGATATTGACTTCATCATATTGCTCGAGCAATATGATGAAGTCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018460
ARHGAP15 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 15
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-118s1c1
Sequence:CCGGCCGTGGAAACACTGAATTCTACTCGAGTAGAATTCAGTGTTTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-1299s1c1
Sequence:CCGGGACACCATGAAAGTCCTCTTTCTCGAGAAAGAGGACTTTCATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-718s1c1
Sequence:CCGGCCTCTAGCACTGAATTGCTAACTCGAGTTAGCAATTCAGTGCTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-200s1c1
Sequence:CCGGGCTCAGCCAAAGTAAATCCATCTCGAGATGGATTTACTTTGGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018460.2-1232s1c1
Sequence:CCGGGCAAGACAACAACACAAGAATCTCGAGATTCTTGTGTTGTTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018460.3-300s21c1
Sequence:CCGGGGAAGGTCACTGAACCTATATCTCGAGATATAGGTTCAGTGACCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018460.3-665s21c1
Sequence:CCGGGATATTGACTTCATCATATTGCTCGAGCAATATGATGAAGTCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153820
ARHGAP15 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 15
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153820.1-1442s1c1
Sequence:CCGGGCTGACTGAGTACGATAAGATCTCGAGATCTTATCGTACTCAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153820.1-245s1c1
Sequence:CCGGGAATCATTCACAGCATGTGTTCTCGAGAACACATGCTGTGAATGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153820.1-584s1c1
Sequence:CCGGCTTCCTCATATTGGATTGGTTCTCGAGAACCAATCCAATATGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153820.1-282s1c1
Sequence:CCGGCCACTAGAACATCCAATGGTTCTCGAGAACCATTGGATGTTCTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153820.1-258s1c1
Sequence:CCGGCATGTGTTGAAAGATGTCATTCTCGAGAATGACATCTTTCAACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153820.1-179s1c1
Sequence:CCGGCCAAACTAAATCCATGATCCTCTCGAGAGGATCATGGATTTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153820.1-1503s1c1
Sequence:CCGGGAGTATGTTCACATCTGTCTTCTCGAGAAGACAGATGTGAACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153820.1-380s1c1
Sequence:CCGGGATTGTTCTTTCTGGTCGAAACTCGAGTTTCGACCAGAAAGAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153820
ARHGAP15 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 15
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153820.1-1442s1c1
Sequence:CCGGGCTGACTGAGTACGATAAGATCTCGAGATCTTATCGTACTCAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153820.1-245s1c1
Sequence:CCGGGAATCATTCACAGCATGTGTTCTCGAGAACACATGCTGTGAATGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153820.1-584s1c1
Sequence:CCGGCTTCCTCATATTGGATTGGTTCTCGAGAACCAATCCAATATGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153820.1-282s1c1
Sequence:CCGGCCACTAGAACATCCAATGGTTCTCGAGAACCATTGGATGTTCTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153820.1-258s1c1
Sequence:CCGGCATGTGTTGAAAGATGTCATTCTCGAGAATGACATCTTTCAACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153820.1-179s1c1
Sequence:CCGGCCAAACTAAATCCATGATCCTCTCGAGAGGATCATGGATTTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153820.1-1503s1c1
Sequence:CCGGGAGTATGTTCACATCTGTCTTCTCGAGAAGACAGATGTGAACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153820.1-380s1c1
Sequence:CCGGGATTGTTCTTTCTGGTCGAAACTCGAGTTTCGACCAGAAAGAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153820
ARHGAP15 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 15
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153820.1-1442s1c1
Sequence:CCGGGCTGACTGAGTACGATAAGATCTCGAGATCTTATCGTACTCAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153820.1-245s1c1
Sequence:CCGGGAATCATTCACAGCATGTGTTCTCGAGAACACATGCTGTGAATGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153820.1-584s1c1
Sequence:CCGGCTTCCTCATATTGGATTGGTTCTCGAGAACCAATCCAATATGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153820.1-282s1c1
Sequence:CCGGCCACTAGAACATCCAATGGTTCTCGAGAACCATTGGATGTTCTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153820.1-258s1c1
Sequence:CCGGCATGTGTTGAAAGATGTCATTCTCGAGAATGACATCTTTCAACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153820.1-179s1c1
Sequence:CCGGCCAAACTAAATCCATGATCCTCTCGAGAGGATCATGGATTTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153820.1-1503s1c1
Sequence:CCGGGAGTATGTTCACATCTGTCTTCTCGAGAAGACAGATGTGAACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153820.1-380s1c1
Sequence:CCGGGATTGTTCTTTCTGGTCGAAACTCGAGTTTCGACCAGAAAGAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks