EMAIL THIS PAGE TO A FRIEND

ARHGAP17

Rho GTPase activating protein 17

189 Gene Product Result for
Synonyms: MST066 MST110 MSTP038 MSTP066 MSTP110 NADRIN PP367 PP4534 RICH1 RICH1B WBP15
Gene ID:
Human(55114) Summary: RICH1 is a GTPase-activating protein (GAP). GAPs stimulate the intrinsic GTP hydrolysis of small G proteins, such as RHOA (MIM 165390), RAC1 (MIM 602048), and CDC42 (MIM 116952).[supplied by OMIM, Apr 2004]
Mouse(70497) Rho GTPase activating protein 17
Rat(63994) Rho GTPase activating protein 17
chicken(416564) Rho GTPase activating protein 17
domestic cat(101088205) Rho GTPase activating protein 17
cow(504245) Rho GTPase activating protein 17
Horse(100069347) Rho GTPase activating protein 17
dog(489964) Rho GTPase activating protein 17
naked mole-rat(101697661) Rho GTPase activating protein 17
domestic guinea pig(100719368) Rho GTPase activating protein 17
sheep(101119180) Rho GTPase activating protein 17
Domestic Rabbit(100357058) Rho GTPase activating protein 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018054 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006634 Rosetta Predictions human pricing
NM_018054 Rosetta Predictions human pricing
NM_022244 Rosetta Predictions rat pricing
NM_001122640 Rosetta Predictions mouse pricing
NM_001122641 Rosetta Predictions mouse pricing
NM_001122642 Rosetta Predictions mouse pricing
NM_001122643 Rosetta Predictions mouse pricing
NM_144529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073341 predicted 564
2 SASI_Hs01_00073342 predicted 1159
3 SASI_Hs01_00073343 predicted 792
4 SASI_Hs01_00073344 predicted 712
5 SASI_Hs02_00305102 predicted 2831
6 SASI_Hs01_00073345 predicted 1297
7 SASI_Hs01_00073347 predicted 806
8 SASI_Hs01_00073348 predicted 881
9 SASI_Hs01_00073349 predicted 515
10 SASI_Hs01_00073350 predicted 1133
11 SASI_Hs01_00073346 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238305 predicted 565
2 SASI_Hs01_00238306 predicted 1161
3 SASI_Hs01_00238307 predicted 793
4 SASI_Hs01_00238308 predicted 711
5 SASI_Hs02_00351187 predicted 2597
6 SASI_Hs01_00238309 predicted 1300
7 SASI_Hs01_00238311 predicted 805
8 SASI_Hs01_00238312 predicted 875
9 SASI_Hs01_00238313 predicted 516
10 SASI_Hs01_00238314 predicted 1132
11 SASI_Hs01_00238310 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034794 predicted 1414
2 SASI_Rn01_00034796 predicted 443
3 SASI_Rn01_00034797 predicted 880
4 SASI_Rn01_00034798 predicted 1627
5 SASI_Rn02_00263018 predicted 2323
6 SASI_Rn01_00034801 predicted 555
7 SASI_Rn01_00034802 predicted 493
8 SASI_Rn01_00034803 predicted 785
9 SASI_Rn02_00263019 predicted 1121
10 SASI_Rn02_00263020 predicted 869
11 SASI_Rn01_00034795 predicted 379
12 SASI_Rn01_00034799 predicted 1157
13 SASI_Rn01_00034800 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309107 predicted 639
2 SASI_Mm02_00309108 predicted 414
3 SASI_Mm02_00309109 predicted 1171
4 SASI_Mm02_00309110 predicted 908
5 SASI_Mm02_00309111 predicted 576
6 SASI_Mm02_00309112 predicted 805
7 SASI_Mm02_00309113 predicted 1144
8 SASI_Mm02_00309114 predicted 910
9 SASI_Mm02_00309115 predicted 747
10 SASI_Mm02_00309116 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309117 predicted 636
2 SASI_Mm02_00309118 predicted 418
3 SASI_Mm02_00309119 predicted 1168
4 SASI_Mm02_00309120 predicted 901
5 SASI_Mm02_00309121 predicted 582
6 SASI_Mm02_00309122 predicted 809
7 SASI_Mm02_00309123 predicted 1151
8 SASI_Mm02_00309124 predicted 904
9 SASI_Mm02_00309125 predicted 738
10 SASI_Mm02_00309126 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309127 predicted 636
2 SASI_Mm02_00309128 predicted 419
3 SASI_Mm02_00309129 predicted 1173
4 SASI_Mm02_00309130 predicted 910
5 SASI_Mm02_00309131 predicted 578
6 SASI_Mm02_00309132 predicted 812
7 SASI_Mm02_00309133 predicted 1142
8 SASI_Mm02_00309134 predicted 908
9 SASI_Mm02_00309135 predicted 747
10 SASI_Mm02_00309136 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309137 predicted 638
2 SASI_Mm02_00309138 predicted 414
3 SASI_Mm02_00309139 predicted 1172
4 SASI_Mm02_00309140 predicted 901
5 SASI_Mm02_00309141 predicted 583
6 SASI_Mm02_00309142 predicted 807
7 SASI_Mm02_00309143 predicted 1144
8 SASI_Mm02_00309144 predicted 909
9 SASI_Mm02_00309145 predicted 741
10 SASI_Mm02_00309146 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340048 predicted 645
2 SASI_Mm02_00340049 predicted 417
3 SASI_Mm02_00340050 predicted 1173
4 SASI_Mm01_00078672 predicted 902
5 SASI_Mm01_00078673 predicted 580
6 SASI_Mm01_00078677 predicted 806
7 SASI_Mm01_00078678 predicted 1149
8 SASI_Mm02_00340051 predicted 910
9 SASI_Mm02_00340052 predicted 744
10 SASI_Mm01_00078679 predicted 1299
11 SASI_Mm01_00078671 predicted 2521
12 SASI_Mm01_00078674 predicted 664
13 SASI_Mm01_00078675 predicted 1447
14 SASI_Mm01_00078676 predicted 2510
15 SASI_Mm01_00078680 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144529
VALIDATED
ARHGAP17 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 17
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144529.2-2904s21c1
Sequence:CCGGTACCGACAGCAGGAGTATTACCTCGAGGTAATACTCCTGCTGTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144529.2-238s21c1
Sequence:CCGGCCACCATTCACATAAGCGTTTCTCGAGAAACGCTTATGTGAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144529.2-1266s21c1
Sequence:CCGGCCCAGACCAGTGACGTTAATACTCGAGTATTAACGTCACTGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144529.2-736s21c1
Sequence:CCGGCAAGTTCTTCGTGACGTTATTCTCGAGAATAACGTCACGAAGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144529.2-215s21c1
Sequence:CCGGCTGGACACTGTGCGTTCAATGCTCGAGCATTGAACGCACAGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144529.1-3218s1c1
Sequence:CCGGGCCAGAATATGGAGAGAAATACTCGAGTATTTCTCTCCATATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144529.1-236s1c1
Sequence:CCGGCCACCATTCACATAAGCGTTTCTCGAGAAACGCTTATGTGAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144529.1-420s1c1
Sequence:CCGGGCTCTTGAACTCTCACAACATCTCGAGATGTTGTGAGAGTTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144529.1-1264s1c1
Sequence:CCGGCCCAGACCAGTGACGTTAATACTCGAGTATTAACGTCACTGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144529.1-2338s1c1
Sequence:CCGGCCAAGCAGAATCCATCGCAAACTCGAGTTTGCGATGGATTCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144529
VALIDATED
ARHGAP17 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 17
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144529.2-2904s21c1
Sequence:CCGGTACCGACAGCAGGAGTATTACCTCGAGGTAATACTCCTGCTGTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144529.2-238s21c1
Sequence:CCGGCCACCATTCACATAAGCGTTTCTCGAGAAACGCTTATGTGAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144529.2-1266s21c1
Sequence:CCGGCCCAGACCAGTGACGTTAATACTCGAGTATTAACGTCACTGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144529.2-736s21c1
Sequence:CCGGCAAGTTCTTCGTGACGTTATTCTCGAGAATAACGTCACGAAGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144529.2-215s21c1
Sequence:CCGGCTGGACACTGTGCGTTCAATGCTCGAGCATTGAACGCACAGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144529.1-3218s1c1
Sequence:CCGGGCCAGAATATGGAGAGAAATACTCGAGTATTTCTCTCCATATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144529.1-236s1c1
Sequence:CCGGCCACCATTCACATAAGCGTTTCTCGAGAAACGCTTATGTGAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144529.1-420s1c1
Sequence:CCGGGCTCTTGAACTCTCACAACATCTCGAGATGTTGTGAGAGTTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144529.1-1264s1c1
Sequence:CCGGCCCAGACCAGTGACGTTAATACTCGAGTATTAACGTCACTGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144529.1-2338s1c1
Sequence:CCGGCCAAGCAGAATCCATCGCAAACTCGAGTTTGCGATGGATTCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144529
VALIDATED
ARHGAP17 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 17
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144529.2-2904s21c1
Sequence:CCGGTACCGACAGCAGGAGTATTACCTCGAGGTAATACTCCTGCTGTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144529.2-238s21c1
Sequence:CCGGCCACCATTCACATAAGCGTTTCTCGAGAAACGCTTATGTGAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144529.2-1266s21c1
Sequence:CCGGCCCAGACCAGTGACGTTAATACTCGAGTATTAACGTCACTGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144529.2-736s21c1
Sequence:CCGGCAAGTTCTTCGTGACGTTATTCTCGAGAATAACGTCACGAAGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144529.2-215s21c1
Sequence:CCGGCTGGACACTGTGCGTTCAATGCTCGAGCATTGAACGCACAGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144529.1-3218s1c1
Sequence:CCGGGCCAGAATATGGAGAGAAATACTCGAGTATTTCTCTCCATATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144529.1-236s1c1
Sequence:CCGGCCACCATTCACATAAGCGTTTCTCGAGAAACGCTTATGTGAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144529.1-420s1c1
Sequence:CCGGGCTCTTGAACTCTCACAACATCTCGAGATGTTGTGAGAGTTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144529.1-1264s1c1
Sequence:CCGGCCCAGACCAGTGACGTTAATACTCGAGTATTAACGTCACTGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144529.1-2338s1c1
Sequence:CCGGCCAAGCAGAATCCATCGCAAACTCGAGTTTGCGATGGATTCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018054
VALIDATED
ARHGAP17 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 17
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-1470s21c1
Sequence:CCGGCCCGAGTTCTAATCACTCATTCTCGAGAATGAGTGATTAGAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-746s21c1
Sequence:CCGGCCCAAGCAGATTACCATAGAACTCGAGTTCTATGGTAATCTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-423s21c1
Sequence:CCGGGCACGAAGTCTTTGTTGAGAACTCGAGTTCTCAACAAAGACTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-1817s21c1
Sequence:CCGGGCCAGAGTTCTTCAGGAACATCTCGAGATGTTCCTGAAGAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-2870s21c1
Sequence:CCGGAGTGCGTTAACTATCTATTTACTCGAGTAAATAGATAGTTAACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-1447s1c1
Sequence:CCGGCCCGAGTTCTAATCACTCATTCTCGAGAATGAGTGATTAGAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-1355s1c1
Sequence:CCGGGCAGTGATTGAACCCATCATTCTCGAGAATGATGGGTTCAATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-400s1c1
Sequence:CCGGGCACGAAGTCTTTGTTGAGAACTCGAGTTCTCAACAAAGACTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-1794s1c1
Sequence:CCGGGCCAGAGTTCTTCAGGAACATCTCGAGATGTTCCTGAAGAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-723s1c1
Sequence:CCGGCCCAAGCAGATTACCATAGAACTCGAGTTCTATGGTAATCTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018054
VALIDATED
ARHGAP17 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 17
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-1470s21c1
Sequence:CCGGCCCGAGTTCTAATCACTCATTCTCGAGAATGAGTGATTAGAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-746s21c1
Sequence:CCGGCCCAAGCAGATTACCATAGAACTCGAGTTCTATGGTAATCTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-423s21c1
Sequence:CCGGGCACGAAGTCTTTGTTGAGAACTCGAGTTCTCAACAAAGACTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-1817s21c1
Sequence:CCGGGCCAGAGTTCTTCAGGAACATCTCGAGATGTTCCTGAAGAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-2870s21c1
Sequence:CCGGAGTGCGTTAACTATCTATTTACTCGAGTAAATAGATAGTTAACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-1447s1c1
Sequence:CCGGCCCGAGTTCTAATCACTCATTCTCGAGAATGAGTGATTAGAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-1355s1c1
Sequence:CCGGGCAGTGATTGAACCCATCATTCTCGAGAATGATGGGTTCAATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-400s1c1
Sequence:CCGGGCACGAAGTCTTTGTTGAGAACTCGAGTTCTCAACAAAGACTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-1794s1c1
Sequence:CCGGGCCAGAGTTCTTCAGGAACATCTCGAGATGTTCCTGAAGAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-723s1c1
Sequence:CCGGCCCAAGCAGATTACCATAGAACTCGAGTTCTATGGTAATCTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018054
VALIDATED
ARHGAP17 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 17
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-1470s21c1
Sequence:CCGGCCCGAGTTCTAATCACTCATTCTCGAGAATGAGTGATTAGAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-746s21c1
Sequence:CCGGCCCAAGCAGATTACCATAGAACTCGAGTTCTATGGTAATCTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-423s21c1
Sequence:CCGGGCACGAAGTCTTTGTTGAGAACTCGAGTTCTCAACAAAGACTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-1817s21c1
Sequence:CCGGGCCAGAGTTCTTCAGGAACATCTCGAGATGTTCCTGAAGAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018054.4-2870s21c1
Sequence:CCGGAGTGCGTTAACTATCTATTTACTCGAGTAAATAGATAGTTAACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-1447s1c1
Sequence:CCGGCCCGAGTTCTAATCACTCATTCTCGAGAATGAGTGATTAGAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-1355s1c1
Sequence:CCGGGCAGTGATTGAACCCATCATTCTCGAGAATGATGGGTTCAATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-400s1c1
Sequence:CCGGGCACGAAGTCTTTGTTGAGAACTCGAGTTCTCAACAAAGACTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-1794s1c1
Sequence:CCGGGCCAGAGTTCTTCAGGAACATCTCGAGATGTTCCTGAAGAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018054.3-723s1c1
Sequence:CCGGCCCAAGCAGATTACCATAGAACTCGAGTTCTATGGTAATCTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks