EMAIL THIS PAGE TO A FRIEND

ARHGAP18

Rho GTPase activating protein 18

130 Gene Product Result for
Synonyms: MacGAP SENEX bA307O14.2
UniProtKB ID: Q8N392, E1P575, Q58EZ3, Q6P679, Q6PJD7, Q96S64
Gene ID:
Human(93663) Summary: ARHGAP18 belongs to a family of Rho (see MIM 165390) GTPase-activating proteins that modulate cell signaling (Potkin et al., 2009 [PubMed 19065146]
Mouse(73910) Rho GTPase activating protein 18
Rat(293947) Rho GTPase activating protein 18
chicken(421706) Rho GTPase activating protein 18
dog(476292) Rho GTPase activating protein 18
Horse(100073070) Rho GTPase activating protein 18
cow(510743) Rho GTPase activating protein 18
domestic cat(101087578) Rho GTPase activating protein 18
sheep(101118792) Rho GTPase activating protein 18
domestic guinea pig(100729447) Rho GTPase activating protein 18
naked mole-rat(101726249) Rho GTPase activating protein 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033515 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033515 Rosetta Predictions human pricing
NM_001106354 Rosetta Predictions rat pricing
NM_176837 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137591 predicted 1858
2 SASI_Hs01_00137592 predicted 854
3 SASI_Hs01_00137593 predicted 944
4 SASI_Hs01_00137594 predicted 313
5 SASI_Hs02_00361401 predicted 1536
6 SASI_Hs01_00137597 predicted 1726
7 SASI_Hs01_00137598 predicted 1394
8 SASI_Hs01_00137599 predicted 2011
9 SASI_Hs01_00137600 predicted 2018
10 SASI_Hs02_00361402 predicted 975
11 SASI_Hs01_00137595 predicted 1665
12 SASI_Hs01_00137596 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218148 predicted 220
2 SASI_Rn02_00218149 predicted 222
3 SASI_Rn02_00218150 predicted 218
4 SASI_Rn02_00218151 predicted 192
5 SASI_Rn02_00218152 predicted 216
6 SASI_Rn02_00218153 predicted 373
7 SASI_Rn02_00218154 predicted 133
8 SASI_Rn02_00218155 predicted 122
9 SASI_Rn02_00218156 predicted 391
10 SASI_Rn02_00218157 predicted 140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086431 predicted 289
2 SASI_Mm01_00086432 predicted 937
3 SASI_Mm01_00086433 predicted 240
4 SASI_Mm01_00086434 predicted 1840
5 SASI_Mm01_00086435 predicted 1085
6 SASI_Mm01_00086436 predicted 1558
7 SASI_Mm01_00086437 predicted 1520
8 SASI_Mm01_00086438 predicted 1779
9 SASI_Mm01_00086439 predicted 1451
10 SASI_Mm01_00086440 predicted 1597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033515
VALIDATED
ARHGAP18 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-1996s1c1
Sequence:CCGGGCTGCCTTGATGATGACACTTCTCGAGAAGTGTCATCATCAAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-979s1c1
Sequence:CCGGCCCTCTATGATGTATTGGGTACTCGAGTACCCAATACATCATAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-1194s1c1
Sequence:CCGGGCTGCCATTAGAATCAAGAATCTCGAGATTCTTGATTCTAATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-264s1c1
Sequence:CCGGCCTCCATTTGATCGATCAATTCTCGAGAATTGATCGATCAAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-1539s1c1
Sequence:CCGGCCGAATCTCTTTATGTGTCATCTCGAGATGACACATAAAGAGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_033515.2-594s21c1
Sequence:CCGGCCTGACGTCAGAGACATATTTCTCGAGAAATATGTCTCTGACGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_033515.2-1194s21c1
Sequence:CCGGGCTGCCATTAGAATCAAGAATCTCGAGATTCTTGATTCTAATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033515.2-1996s21c1
Sequence:CCGGGCTGCCTTGATGATGACACTTCTCGAGAAGTGTCATCATCAAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_033515.2-2298s21c1
Sequence:CCGGTGAGAGTAAAGAGGCTTAATTCTCGAGAATTAAGCCTCTTTACTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033515
VALIDATED
ARHGAP18 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-1996s1c1
Sequence:CCGGGCTGCCTTGATGATGACACTTCTCGAGAAGTGTCATCATCAAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-979s1c1
Sequence:CCGGCCCTCTATGATGTATTGGGTACTCGAGTACCCAATACATCATAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-1194s1c1
Sequence:CCGGGCTGCCATTAGAATCAAGAATCTCGAGATTCTTGATTCTAATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-264s1c1
Sequence:CCGGCCTCCATTTGATCGATCAATTCTCGAGAATTGATCGATCAAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-1539s1c1
Sequence:CCGGCCGAATCTCTTTATGTGTCATCTCGAGATGACACATAAAGAGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_033515.2-594s21c1
Sequence:CCGGCCTGACGTCAGAGACATATTTCTCGAGAAATATGTCTCTGACGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_033515.2-1194s21c1
Sequence:CCGGGCTGCCATTAGAATCAAGAATCTCGAGATTCTTGATTCTAATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033515.2-1996s21c1
Sequence:CCGGGCTGCCTTGATGATGACACTTCTCGAGAAGTGTCATCATCAAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_033515.2-2298s21c1
Sequence:CCGGTGAGAGTAAAGAGGCTTAATTCTCGAGAATTAAGCCTCTTTACTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033515
VALIDATED
ARHGAP18 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-1996s1c1
Sequence:CCGGGCTGCCTTGATGATGACACTTCTCGAGAAGTGTCATCATCAAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-979s1c1
Sequence:CCGGCCCTCTATGATGTATTGGGTACTCGAGTACCCAATACATCATAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-1194s1c1
Sequence:CCGGGCTGCCATTAGAATCAAGAATCTCGAGATTCTTGATTCTAATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-264s1c1
Sequence:CCGGCCTCCATTTGATCGATCAATTCTCGAGAATTGATCGATCAAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033515.2-1539s1c1
Sequence:CCGGCCGAATCTCTTTATGTGTCATCTCGAGATGACACATAAAGAGATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_033515.2-594s21c1
Sequence:CCGGCCTGACGTCAGAGACATATTTCTCGAGAAATATGTCTCTGACGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_033515.2-1194s21c1
Sequence:CCGGGCTGCCATTAGAATCAAGAATCTCGAGATTCTTGATTCTAATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033515.2-1996s21c1
Sequence:CCGGGCTGCCTTGATGATGACACTTCTCGAGAAGTGTCATCATCAAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_033515.2-2298s21c1
Sequence:CCGGTGAGAGTAAAGAGGCTTAATTCTCGAGAATTAAGCCTCTTTACTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176837
VALIDATED
ARHGAP18 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 18
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176837.1-1384s1c1
Sequence:CCGGGCTTTGAACCTCCTTGTCATTCTCGAGAATGACAAGGAGGTTCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176837.1-1455s1c1
Sequence:CCGGCCAAAGAGTCATAGATAACAACTCGAGTTGTTATCTATGACTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176837.1-1593s1c1
Sequence:CCGGGACAGCAAATGTCATGCACTTCTCGAGAAGTGCATGACATTTGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176837.2-1204s1c1
Sequence:CCGGCAAGAACTAGAAGCGAAATTTCTCGAGAAATTTCGCTTCTAGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-1204s21c1
Sequence:CCGGCAAGAACTAGAAGCGAAATTTCTCGAGAAATTTCGCTTCTAGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-1038s21c1
Sequence:CCGGTGGTATTCCTTTAACGATATTCTCGAGAATATCGTTAAAGGAATACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-571s21c1
Sequence:CCGGCGTGACGTCAGAGACATATTTCTCGAGAAATATGTCTCTGACGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-2027s21c1
Sequence:CCGGCGAATGCCGAGTGGGTCATAACTCGAGTTATGACCCACTCGGCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-2138s21c1
Sequence:CCGGATTCAGCTGCACCCAATTATTCTCGAGAATAATTGGGTGCAGCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176837
VALIDATED
ARHGAP18 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 18
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176837.1-1384s1c1
Sequence:CCGGGCTTTGAACCTCCTTGTCATTCTCGAGAATGACAAGGAGGTTCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176837.1-1455s1c1
Sequence:CCGGCCAAAGAGTCATAGATAACAACTCGAGTTGTTATCTATGACTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176837.1-1593s1c1
Sequence:CCGGGACAGCAAATGTCATGCACTTCTCGAGAAGTGCATGACATTTGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176837.2-1204s1c1
Sequence:CCGGCAAGAACTAGAAGCGAAATTTCTCGAGAAATTTCGCTTCTAGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-1204s21c1
Sequence:CCGGCAAGAACTAGAAGCGAAATTTCTCGAGAAATTTCGCTTCTAGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-1038s21c1
Sequence:CCGGTGGTATTCCTTTAACGATATTCTCGAGAATATCGTTAAAGGAATACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-571s21c1
Sequence:CCGGCGTGACGTCAGAGACATATTTCTCGAGAAATATGTCTCTGACGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-2027s21c1
Sequence:CCGGCGAATGCCGAGTGGGTCATAACTCGAGTTATGACCCACTCGGCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-2138s21c1
Sequence:CCGGATTCAGCTGCACCCAATTATTCTCGAGAATAATTGGGTGCAGCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176837
VALIDATED
ARHGAP18 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 18
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176837.1-1384s1c1
Sequence:CCGGGCTTTGAACCTCCTTGTCATTCTCGAGAATGACAAGGAGGTTCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176837.1-1455s1c1
Sequence:CCGGCCAAAGAGTCATAGATAACAACTCGAGTTGTTATCTATGACTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176837.1-1593s1c1
Sequence:CCGGGACAGCAAATGTCATGCACTTCTCGAGAAGTGCATGACATTTGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176837.2-1204s1c1
Sequence:CCGGCAAGAACTAGAAGCGAAATTTCTCGAGAAATTTCGCTTCTAGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-1204s21c1
Sequence:CCGGCAAGAACTAGAAGCGAAATTTCTCGAGAAATTTCGCTTCTAGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-1038s21c1
Sequence:CCGGTGGTATTCCTTTAACGATATTCTCGAGAATATCGTTAAAGGAATACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-571s21c1
Sequence:CCGGCGTGACGTCAGAGACATATTTCTCGAGAAATATGTCTCTGACGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-2027s21c1
Sequence:CCGGCGAATGCCGAGTGGGTCATAACTCGAGTTATGACCCACTCGGCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176837.2-2138s21c1
Sequence:CCGGATTCAGCTGCACCCAATTATTCTCGAGAATAATTGGGTGCAGCTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)