EMAIL THIS PAGE TO A FRIEND

ARHGAP19

Rho GTPase activating protein 19

143 Gene Product Result for
Gene ID:
Human(84986) Summary: Members of the ARHGAP family, such as ARHGAP19, encode negative regulators of Rho GTPases (see RHOA; MIM 165390), which are involved in cell migration, proliferation, and differentiation, actin remodeling, and G1 cell cycle progression (Lv et al., 2007 [PubMed 17454002]
Mouse(71085) Rho GTPase activating protein 19
Rat(679082) Rho GTPase activating protein 19
naked mole-rat(101715509) Rho GTPase activating protein 19
domestic guinea pig(100715198) Rho GTPase activating protein 19
sheep(101113027) Rho GTPase activating protein 19
Domestic Rabbit(100351192) Rho GTPase activating protein 19
Zebrafish(100537002) Rho GTPase activating protein 19
chicken(423846) Rho GTPase activating protein 19
dog(477784) Rho GTPase activating protein 19
Horse(100070751) Rho GTPase activating protein 19
cow(526945) Rho GTPase activating protein 19
domestic cat(101087427) Rho GTPase activating protein 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032900 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080251 MISSION® esiRNA esiRNA targeting mouse Arhgap19 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032900 Rosetta Predictions human pricing
XM_001054615 Rosetta Predictions rat pricing
NM_027667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154242 predicted 1547
2 SASI_Hs02_00360521 predicted 864
3 SASI_Hs01_00154244 predicted 1027
4 SASI_Hs02_00360522 predicted 491
5 SASI_Hs01_00154245 predicted 542
6 SASI_Hs01_00154246 predicted 695
7 SASI_Hs01_00154247 predicted 546
8 SASI_Hs01_00154248 predicted 552
9 SASI_Hs01_00154250 predicted 981
10 SASI_Hs02_00360523 predicted 738
11 SASI_Hs01_00154241 predicted 810
12 SASI_Hs01_00154243 predicted 1192
13 SASI_Hs01_00154249 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276507 predicted 793
2 SASI_Rn02_00276508 predicted 750
3 SASI_Rn02_00276509 predicted 1010
4 SASI_Rn02_00276510 predicted 499
5 SASI_Rn02_00276511 predicted 383
6 SASI_Rn02_00276512 predicted 349
7 SASI_Rn02_00276513 predicted 1192
8 SASI_Rn02_00276514 predicted 990
9 SASI_Rn02_00276515 predicted 1137
10 SASI_Rn02_00276516 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108742 predicted 383
2 SASI_Mm01_00108743 predicted 1231
3 SASI_Mm01_00108744 predicted 471
4 SASI_Mm01_00108745 predicted 853
5 SASI_Mm01_00108746 predicted 508
6 SASI_Mm01_00108747 predicted 986
7 SASI_Mm01_00108748 predicted 625
8 SASI_Mm01_00108749 predicted 500
9 SASI_Mm01_00108750 predicted 334
10 SASI_Mm01_00108751 predicted 1023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032900
VALIDATED
ARHGAP19 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032900.4-978s21c1
Sequence:CCGGTGTGCGAGATTGCACTATTTGCTCGAGCAAATAGTGCAATCTCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032900.4-452s21c1
Sequence:CCGGGTTTAGAGTACCGGGTAATAGCTCGAGCTATTACCCGGTACTCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032900.4-1152s21c1
Sequence:CCGGGAGCTGTTTCAACACGTTCATCTCGAGATGAACGTGTTGAAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032900.4-222s21c1
Sequence:CCGGATCACAAGGCTCATCGATTTACTCGAGTAAATCGATGAGCCTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032900.4-1557s21c1
Sequence:CCGGTTTAGTGGGCAGGTGTTATTCCTCGAGGAATAACACCTGCCCACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-250s1c1
Sequence:CCGGGCTGACACATAAACACTTCAACTCGAGTTGAAGTGTTTATGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-1029s1c1
Sequence:CCGGCCATTGGTGAATTGAAGGGAACTCGAGTTCCCTTCAATTCACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-532s1c1
Sequence:CCGGCCTTCAGGAGAATATCACAAACTCGAGTTTGTGATATTCTCCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-382s1c1
Sequence:CCGGCCCTCCTCCTAATCGTAATTTCTCGAGAAATTACGATTAGGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-800s1c1
Sequence:CCGGGAGCTGTTTCAACACGTTCATCTCGAGATGAACGTGTTGAAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032900
VALIDATED
ARHGAP19 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032900.4-978s21c1
Sequence:CCGGTGTGCGAGATTGCACTATTTGCTCGAGCAAATAGTGCAATCTCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032900.4-452s21c1
Sequence:CCGGGTTTAGAGTACCGGGTAATAGCTCGAGCTATTACCCGGTACTCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032900.4-1152s21c1
Sequence:CCGGGAGCTGTTTCAACACGTTCATCTCGAGATGAACGTGTTGAAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032900.4-222s21c1
Sequence:CCGGATCACAAGGCTCATCGATTTACTCGAGTAAATCGATGAGCCTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032900.4-1557s21c1
Sequence:CCGGTTTAGTGGGCAGGTGTTATTCCTCGAGGAATAACACCTGCCCACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-250s1c1
Sequence:CCGGGCTGACACATAAACACTTCAACTCGAGTTGAAGTGTTTATGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-1029s1c1
Sequence:CCGGCCATTGGTGAATTGAAGGGAACTCGAGTTCCCTTCAATTCACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-532s1c1
Sequence:CCGGCCTTCAGGAGAATATCACAAACTCGAGTTTGTGATATTCTCCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-382s1c1
Sequence:CCGGCCCTCCTCCTAATCGTAATTTCTCGAGAAATTACGATTAGGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-800s1c1
Sequence:CCGGGAGCTGTTTCAACACGTTCATCTCGAGATGAACGTGTTGAAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032900
VALIDATED
ARHGAP19 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032900.4-978s21c1
Sequence:CCGGTGTGCGAGATTGCACTATTTGCTCGAGCAAATAGTGCAATCTCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032900.4-452s21c1
Sequence:CCGGGTTTAGAGTACCGGGTAATAGCTCGAGCTATTACCCGGTACTCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032900.4-1152s21c1
Sequence:CCGGGAGCTGTTTCAACACGTTCATCTCGAGATGAACGTGTTGAAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032900.4-222s21c1
Sequence:CCGGATCACAAGGCTCATCGATTTACTCGAGTAAATCGATGAGCCTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032900.4-1557s21c1
Sequence:CCGGTTTAGTGGGCAGGTGTTATTCCTCGAGGAATAACACCTGCCCACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-250s1c1
Sequence:CCGGGCTGACACATAAACACTTCAACTCGAGTTGAAGTGTTTATGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-1029s1c1
Sequence:CCGGCCATTGGTGAATTGAAGGGAACTCGAGTTCCCTTCAATTCACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-532s1c1
Sequence:CCGGCCTTCAGGAGAATATCACAAACTCGAGTTTGTGATATTCTCCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-382s1c1
Sequence:CCGGCCCTCCTCCTAATCGTAATTTCTCGAGAAATTACGATTAGGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032900.2-800s1c1
Sequence:CCGGGAGCTGTTTCAACACGTTCATCTCGAGATGAACGTGTTGAAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027667
VALIDATED
ARHGAP19 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-979s1c1
Sequence:CCGGGCTCCAGAACTCAAATGTCAACTCGAGTTGACATTTGAGTTCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-1886s1c1
Sequence:CCGGCCAACTGGTATTTGAGGCTTTCTCGAGAAAGCCTCAAATACCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-389s1c1
Sequence:CCGGGCTGATTGAATATCTGCACAACTCGAGTTGTGCAGATATTCAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-1501s1c1
Sequence:CCGGCTTTATTACTTCTGTCCTCTACTCGAGTAGAGGACAGAAGTAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-194s1c1
Sequence:CCGGCAGCAACATCACAAGGCTTATCTCGAGATAAGCCTTGTGATGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027667
VALIDATED
ARHGAP19 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-979s1c1
Sequence:CCGGGCTCCAGAACTCAAATGTCAACTCGAGTTGACATTTGAGTTCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-1886s1c1
Sequence:CCGGCCAACTGGTATTTGAGGCTTTCTCGAGAAAGCCTCAAATACCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-389s1c1
Sequence:CCGGGCTGATTGAATATCTGCACAACTCGAGTTGTGCAGATATTCAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-1501s1c1
Sequence:CCGGCTTTATTACTTCTGTCCTCTACTCGAGTAGAGGACAGAAGTAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-194s1c1
Sequence:CCGGCAGCAACATCACAAGGCTTATCTCGAGATAAGCCTTGTGATGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027667
VALIDATED
ARHGAP19 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-979s1c1
Sequence:CCGGGCTCCAGAACTCAAATGTCAACTCGAGTTGACATTTGAGTTCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-1886s1c1
Sequence:CCGGCCAACTGGTATTTGAGGCTTTCTCGAGAAAGCCTCAAATACCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-389s1c1
Sequence:CCGGGCTGATTGAATATCTGCACAACTCGAGTTGTGCAGATATTCAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-1501s1c1
Sequence:CCGGCTTTATTACTTCTGTCCTCTACTCGAGTAGAGGACAGAAGTAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027667.1-194s1c1
Sequence:CCGGCAGCAACATCACAAGGCTTATCTCGAGATAAGCCTTGTGATGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks