EMAIL THIS PAGE TO A FRIEND

ARHGAP1

Rho GTPase activating protein 1

Synonyms: CDC42GAP RHOGAP RHOGAP1 p50rhoGAP
UniProtKB ID: Q07960, D3DQQ6
Gene ID:
Human(392) Summary: This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein contains a SRC homology 3 domain and interacts with Bcl-2-associated protein family members. [provided by RefSeq, Aug 2012]
Mouse(228359) Rho GTPase activating protein 1
Rat(311193) Rho GTPase activating protein 1
Zebrafish(550478) Rho GTPase activating protein 1
chicken(428865) Rho GTPase activating protein 1
cow(512817) Rho GTPase activating protein 1
Horse(100050810) Rho GTPase activating protein 1
domestic cat(101089546) Rho GTPase activating protein 1
dog(483631) Rho GTPase activating protein 1
sheep(101118219) Rho GTPase activating protein 1
domestic guinea pig(100725449) Rho GTPase activating protein 1
naked mole-rat(101721725) Rho GTPase activating protein 1
Gene Class: Cytoskeleton
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146124 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146124 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146124 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004308 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004308 Rosetta Predictions human pricing
NM_146124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196871 predicted 1546
2 SASI_Hs01_00196872 predicted 1700
3 SASI_Hs01_00196873 predicted 240
4 SASI_Hs01_00196874 predicted 1178
5 SASI_Hs02_00337328 predicted 1082
6 SASI_Hs01_00196877 predicted 233
7 SASI_Hs01_00196878 predicted 1212
8 SASI_Hs01_00196879 predicted 1071
9 SASI_Hs02_00337329 predicted 1693
10 SASI_Hs01_00196880 predicted 414
11 SASI_Hs01_00196875 predicted 325
12 SASI_Hs01_00196876 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198224 predicted 778
2 SASI_Mm01_00198225 predicted 1584
3 SASI_Mm01_00198226 predicted 538
4 SASI_Mm01_00198227 predicted 1535
5 SASI_Mm01_00198228 predicted 1148
6 SASI_Mm01_00198230 predicted 874
7 SASI_Mm01_00198231 predicted 842
8 SASI_Mm01_00198232 predicted 1597
9 SASI_Mm01_00198233 predicted 1425
10 SASI_Mm02_00341788 predicted 394
11 SASI_Mm01_00198229 predicted 841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146124
ARHGAP1 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146124.4-1322s21c1
Sequence:CCGGCCTGAACCCTTGCTAACCTTTCTCGAGAAAGGTTAGCAAGGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146124.4-1501s21c1
Sequence:CCGGCAAGATGACCAACACTAACTTCTCGAGAAGTTAGTGTTGGTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146124.4-1573s21c1
Sequence:CCGGCCTCAAGGCTATCAATCCCATCTCGAGATGGGATTGATAGCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146124.4-1914s21c1
Sequence:CCGGGCTTGGTTCTTCTAGGATTTACTCGAGTAAATCCTAGAAGAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146124.4-560s21c1
Sequence:CCGGATTGTGGAAGTAGCCGGTGATCTCGAGATCACCGGCTACTTCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146124.2-2092s1c1
Sequence:CCGGCCCTGCTAATAGGGATGATAACTCGAGTTATCATCCCTATTAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146124.2-1323s1c1
Sequence:CCGGCCTGAACCCTTGCTAACCTTTCTCGAGAAAGGTTAGCAAGGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146124.2-1574s1c1
Sequence:CCGGCCTCAAGGCTATCAATCCCATCTCGAGATGGGATTGATAGCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146124.2-1502s1c1
Sequence:CCGGCAAGATGACCAACACTAACTTCTCGAGAAGTTAGTGTTGGTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146124.2-966s1c1
Sequence:CCGGCCTCGCCAAGTGCTCAAGTATCTCGAGATACTTGAGCACTTGGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146124
ARHGAP1 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146124.4-1322s21c1
Sequence:CCGGCCTGAACCCTTGCTAACCTTTCTCGAGAAAGGTTAGCAAGGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146124.4-1501s21c1
Sequence:CCGGCAAGATGACCAACACTAACTTCTCGAGAAGTTAGTGTTGGTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146124.4-1573s21c1
Sequence:CCGGCCTCAAGGCTATCAATCCCATCTCGAGATGGGATTGATAGCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146124.4-1914s21c1
Sequence:CCGGGCTTGGTTCTTCTAGGATTTACTCGAGTAAATCCTAGAAGAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146124.4-560s21c1
Sequence:CCGGATTGTGGAAGTAGCCGGTGATCTCGAGATCACCGGCTACTTCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146124.2-2092s1c1
Sequence:CCGGCCCTGCTAATAGGGATGATAACTCGAGTTATCATCCCTATTAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146124.2-1323s1c1
Sequence:CCGGCCTGAACCCTTGCTAACCTTTCTCGAGAAAGGTTAGCAAGGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146124.2-1574s1c1
Sequence:CCGGCCTCAAGGCTATCAATCCCATCTCGAGATGGGATTGATAGCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146124.2-1502s1c1
Sequence:CCGGCAAGATGACCAACACTAACTTCTCGAGAAGTTAGTGTTGGTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146124.2-966s1c1
Sequence:CCGGCCTCGCCAAGTGCTCAAGTATCTCGAGATACTTGAGCACTTGGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146124
ARHGAP1 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146124.4-1322s21c1
Sequence:CCGGCCTGAACCCTTGCTAACCTTTCTCGAGAAAGGTTAGCAAGGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146124.4-1501s21c1
Sequence:CCGGCAAGATGACCAACACTAACTTCTCGAGAAGTTAGTGTTGGTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146124.4-1573s21c1
Sequence:CCGGCCTCAAGGCTATCAATCCCATCTCGAGATGGGATTGATAGCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146124.4-1914s21c1
Sequence:CCGGGCTTGGTTCTTCTAGGATTTACTCGAGTAAATCCTAGAAGAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146124.4-560s21c1
Sequence:CCGGATTGTGGAAGTAGCCGGTGATCTCGAGATCACCGGCTACTTCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146124.2-2092s1c1
Sequence:CCGGCCCTGCTAATAGGGATGATAACTCGAGTTATCATCCCTATTAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146124.2-1323s1c1
Sequence:CCGGCCTGAACCCTTGCTAACCTTTCTCGAGAAAGGTTAGCAAGGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146124.2-1574s1c1
Sequence:CCGGCCTCAAGGCTATCAATCCCATCTCGAGATGGGATTGATAGCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146124.2-1502s1c1
Sequence:CCGGCAAGATGACCAACACTAACTTCTCGAGAAGTTAGTGTTGGTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146124.2-966s1c1
Sequence:CCGGCCTCGCCAAGTGCTCAAGTATCTCGAGATACTTGAGCACTTGGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004308
VALIDATED
ARHGAP1 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004308.2-976s21c1
Sequence:CCGGGTGGATTTCGACCAGTACAATCTCGAGATTGTACTGGTCGAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004308.2-552s21c1
Sequence:CCGGGCATCCAACCATGTTCATCAACTCGAGTTGATGAACATGGTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004308.2-193s21c1
Sequence:CCGGCCCAAGTCAGATGACTCCAAACTCGAGTTTGGAGTCATCTGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004308.2-171s21c1
Sequence:CCGGCTCGGATGAAATGCCTGACTTCTCGAGAAGTCAGGCATTTCATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004308.2-688s1c1
Sequence:CCGGCCTCGCCAAGTGCTCAAATATCTCGAGATATTTGAGCACTTGGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004308.2-552s1c1
Sequence:CCGGGCATCCAACCATGTTCATCAACTCGAGTTGATGAACATGGTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004308.2-193s1c1
Sequence:CCGGCCCAAGTCAGATGACTCCAAACTCGAGTTTGGAGTCATCTGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004308.2-976s1c1
Sequence:CCGGGTGGATTTCGACCAGTACAATCTCGAGATTGTACTGGTCGAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004308.2-171s1c1
Sequence:CCGGCTCGGATGAAATGCCTGACTTCTCGAGAAGTCAGGCATTTCATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004308
VALIDATED
ARHGAP1 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004308.2-976s21c1
Sequence:CCGGGTGGATTTCGACCAGTACAATCTCGAGATTGTACTGGTCGAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004308.2-552s21c1
Sequence:CCGGGCATCCAACCATGTTCATCAACTCGAGTTGATGAACATGGTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004308.2-193s21c1
Sequence:CCGGCCCAAGTCAGATGACTCCAAACTCGAGTTTGGAGTCATCTGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004308.2-171s21c1
Sequence:CCGGCTCGGATGAAATGCCTGACTTCTCGAGAAGTCAGGCATTTCATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004308.2-688s1c1
Sequence:CCGGCCTCGCCAAGTGCTCAAATATCTCGAGATATTTGAGCACTTGGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004308.2-552s1c1
Sequence:CCGGGCATCCAACCATGTTCATCAACTCGAGTTGATGAACATGGTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004308.2-193s1c1
Sequence:CCGGCCCAAGTCAGATGACTCCAAACTCGAGTTTGGAGTCATCTGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004308.2-976s1c1
Sequence:CCGGGTGGATTTCGACCAGTACAATCTCGAGATTGTACTGGTCGAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004308.2-171s1c1
Sequence:CCGGCTCGGATGAAATGCCTGACTTCTCGAGAAGTCAGGCATTTCATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004308
VALIDATED
ARHGAP1 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004308.2-976s21c1
Sequence:CCGGGTGGATTTCGACCAGTACAATCTCGAGATTGTACTGGTCGAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004308.2-552s21c1
Sequence:CCGGGCATCCAACCATGTTCATCAACTCGAGTTGATGAACATGGTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004308.2-193s21c1
Sequence:CCGGCCCAAGTCAGATGACTCCAAACTCGAGTTTGGAGTCATCTGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004308.2-171s21c1
Sequence:CCGGCTCGGATGAAATGCCTGACTTCTCGAGAAGTCAGGCATTTCATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004308.2-688s1c1
Sequence:CCGGCCTCGCCAAGTGCTCAAATATCTCGAGATATTTGAGCACTTGGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004308.2-552s1c1
Sequence:CCGGGCATCCAACCATGTTCATCAACTCGAGTTGATGAACATGGTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004308.2-193s1c1
Sequence:CCGGCCCAAGTCAGATGACTCCAAACTCGAGTTTGGAGTCATCTGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004308.2-976s1c1
Sequence:CCGGGTGGATTTCGACCAGTACAATCTCGAGATTGTACTGGTCGAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004308.2-171s1c1
Sequence:CCGGCTCGGATGAAATGCCTGACTTCTCGAGAAGTCAGGCATTTCATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks