EMAIL THIS PAGE TO A FRIEND

ARHGAP20

Rho GTPase activating protein 20

123 Gene Product Result for
Synonyms: RARHOGAP
Gene ID:
Mouse(244867) Rho GTPase activating protein 20
Rat(367085) Rho GTPase activating protein 20
Zebrafish(796434) Rho GTPase activating protein 20
chicken(418962) Rho GTPase activating protein 20
dog(611451) Rho GTPase activating protein 20
domestic cat(101091138) Rho GTPase activating protein 20
Horse(100070234) Rho GTPase activating protein 20
cow(515501) Rho GTPase activating protein 20
sheep(101106623) Rho GTPase activating protein 20
Domestic Rabbit(100352377) Rho GTPase activating protein 20
domestic guinea pig(100719450) Rho GTPase activating protein 20
naked mole-rat(101715493) Rho GTPase activating protein 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020809 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175535 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175535 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175535 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020809 Rosetta Predictions human pricing
NM_213629 Rosetta Predictions rat pricing
NM_175535 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077488 predicted 1983
2 SASI_Hs02_00353990 predicted 979
3 SASI_Hs01_00077490 predicted 1569
4 SASI_Hs01_00077491 predicted 1496
5 SASI_Hs01_00077492 predicted 901
6 SASI_Hs01_00077493 predicted 3822
7 SASI_Hs01_00077495 predicted 3681
8 SASI_Hs01_00077496 predicted 2938
9 SASI_Hs01_00077497 predicted 2402
10 SASI_Hs02_00353991 predicted 2139
11 SASI_Hs01_00077489 predicted 3857
12 SASI_Hs01_00077494 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115511 predicted 3380
2 SASI_Rn01_00115512 predicted 1489
3 SASI_Rn01_00115513 predicted 1586
4 SASI_Rn01_00115515 predicted 1617
5 SASI_Rn01_00115516 predicted 284
6 SASI_Rn01_00115517 predicted 3644
7 SASI_Rn01_00115518 predicted 1327
8 SASI_Rn02_00270620 predicted 2445
9 SASI_Rn01_00115519 predicted 804
10 SASI_Rn01_00115520 predicted 3294
11 SASI_Rn01_00115514 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072700 predicted 2058
2 SASI_Mm01_00072701 predicted 2801
3 SASI_Mm01_00072702 predicted 1651
4 SASI_Mm02_00346488 predicted 854
5 SASI_Mm02_00346489 predicted 1069
6 SASI_Mm01_00072703 predicted 1682
7 SASI_Mm01_00072704 predicted 3542
8 SASI_Mm01_00072705 predicted 916
9 SASI_Mm01_00072706 predicted 2959
10 SASI_Mm01_00072708 predicted 3715
11 SASI_Mm01_00072707 predicted 472
12 SASI_Mm01_00072709 predicted 2608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020809
ARHGAP20 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 20
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020809.1-5025s1c1
Sequence:CCGGCCCAAATGTTTCATGGCTTATCTCGAGATAAGCCATGAAACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020809.1-2212s1c1
Sequence:CCGGGCCCATTCTAAAGATGAAGATCTCGAGATCTTCATCTTTAGAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020809.1-430s1c1
Sequence:CCGGCCATCTCTTATCCTGGATAAACTCGAGTTTATCCAGGATAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020809.1-2408s1c1
Sequence:CCGGGCATCGACTATCTGGATTCAACTCGAGTTGAATCCAGATAGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020809.1-3203s1c1
Sequence:CCGGCCTCTCCAATAGATTGCACTTCTCGAGAAGTGCAATCTATTGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020809.2-1918s21c1
Sequence:CCGGGAGAATTGCCTTAGGATATTTCTCGAGAAATATCCTAAGGCAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020809.2-3888s21c1
Sequence:CCGGGAACAGGAACTGGGTTAATAACTCGAGTTATTAACCCAGTTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020809.2-3826s21c1
Sequence:CCGGGACATTGAGGACAGGTATTTACTCGAGTAAATACCTGTCCTCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020809
ARHGAP20 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 20
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020809.1-5025s1c1
Sequence:CCGGCCCAAATGTTTCATGGCTTATCTCGAGATAAGCCATGAAACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020809.1-2212s1c1
Sequence:CCGGGCCCATTCTAAAGATGAAGATCTCGAGATCTTCATCTTTAGAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020809.1-430s1c1
Sequence:CCGGCCATCTCTTATCCTGGATAAACTCGAGTTTATCCAGGATAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020809.1-2408s1c1
Sequence:CCGGGCATCGACTATCTGGATTCAACTCGAGTTGAATCCAGATAGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020809.1-3203s1c1
Sequence:CCGGCCTCTCCAATAGATTGCACTTCTCGAGAAGTGCAATCTATTGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020809.2-1918s21c1
Sequence:CCGGGAGAATTGCCTTAGGATATTTCTCGAGAAATATCCTAAGGCAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020809.2-3888s21c1
Sequence:CCGGGAACAGGAACTGGGTTAATAACTCGAGTTATTAACCCAGTTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020809.2-3826s21c1
Sequence:CCGGGACATTGAGGACAGGTATTTACTCGAGTAAATACCTGTCCTCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020809
ARHGAP20 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 20
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020809.1-5025s1c1
Sequence:CCGGCCCAAATGTTTCATGGCTTATCTCGAGATAAGCCATGAAACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020809.1-2212s1c1
Sequence:CCGGGCCCATTCTAAAGATGAAGATCTCGAGATCTTCATCTTTAGAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020809.1-430s1c1
Sequence:CCGGCCATCTCTTATCCTGGATAAACTCGAGTTTATCCAGGATAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020809.1-2408s1c1
Sequence:CCGGGCATCGACTATCTGGATTCAACTCGAGTTGAATCCAGATAGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020809.1-3203s1c1
Sequence:CCGGCCTCTCCAATAGATTGCACTTCTCGAGAAGTGCAATCTATTGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020809.2-1918s21c1
Sequence:CCGGGAGAATTGCCTTAGGATATTTCTCGAGAAATATCCTAAGGCAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020809.2-3888s21c1
Sequence:CCGGGAACAGGAACTGGGTTAATAACTCGAGTTATTAACCCAGTTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020809.2-3826s21c1
Sequence:CCGGGACATTGAGGACAGGTATTTACTCGAGTAAATACCTGTCCTCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175535
VALIDATED
ARHGAP20 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175535.3-4572s1c1
Sequence:CCGGGCGCAGAAGAATAGCCACATACTCGAGTATGTGGCTATTCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175535.3-635s1c1
Sequence:CCGGCCGTGAACTTTGTGGCTACTTCTCGAGAAGTAGCCACAAAGTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175535.3-1059s1c1
Sequence:CCGGCGAGATGCAATGCCAGTTCATCTCGAGATGAACTGGCATTGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175535.3-877s1c1
Sequence:CCGGGATTACCAACTGTGGGTAAATCTCGAGATTTACCCACAGTTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175535.3-3192s1c1
Sequence:CCGGCCACCTAGCTTATTTAAGAAACTCGAGTTTCTTAAATAAGCTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175535
VALIDATED
ARHGAP20 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175535.3-4572s1c1
Sequence:CCGGGCGCAGAAGAATAGCCACATACTCGAGTATGTGGCTATTCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175535.3-635s1c1
Sequence:CCGGCCGTGAACTTTGTGGCTACTTCTCGAGAAGTAGCCACAAAGTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175535.3-1059s1c1
Sequence:CCGGCGAGATGCAATGCCAGTTCATCTCGAGATGAACTGGCATTGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175535.3-877s1c1
Sequence:CCGGGATTACCAACTGTGGGTAAATCTCGAGATTTACCCACAGTTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175535.3-3192s1c1
Sequence:CCGGCCACCTAGCTTATTTAAGAAACTCGAGTTTCTTAAATAAGCTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175535
VALIDATED
ARHGAP20 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175535.3-4572s1c1
Sequence:CCGGGCGCAGAAGAATAGCCACATACTCGAGTATGTGGCTATTCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175535.3-635s1c1
Sequence:CCGGCCGTGAACTTTGTGGCTACTTCTCGAGAAGTAGCCACAAAGTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175535.3-1059s1c1
Sequence:CCGGCGAGATGCAATGCCAGTTCATCTCGAGATGAACTGGCATTGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175535.3-877s1c1
Sequence:CCGGGATTACCAACTGTGGGTAAATCTCGAGATTTACCCACAGTTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175535.3-3192s1c1
Sequence:CCGGCCACCTAGCTTATTTAAGAAACTCGAGTTTCTTAAATAAGCTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks