EMAIL THIS PAGE TO A FRIEND

ARHGAP21

Rho GTPase activating protein 21

190 Gene Product Result for
Synonyms: ARHGAP10
Gene ID:
Human(57584) Summary: ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]
Mouse(71435) Rho GTPase activating protein 21
Rat(307178) Rho GTPase activating protein 21
chicken(420500) Rho GTPase activating protein 21
dog(100687590) Rho GTPase activating protein 21
Horse(100066007) Rho GTPase activating protein 21
cow(538584) Rho GTPase activating protein 21
domestic cat(101086237) Rho GTPase activating protein 21
naked mole-rat(101703318) Rho GTPase activating protein 21
domestic guinea pig(100712608) Rho GTPase activating protein 21
sheep(101114376) Rho GTPase activating protein 21
Domestic Rabbit(100338000) Rho GTPase activating protein 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020824 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020824 Rosetta Predictions human pricing
XM_001074395 Rosetta Predictions rat pricing
XM_225628 Rosetta Predictions rat pricing
NM_001081364 Rosetta Predictions mouse pricing
NM_001128084 Rosetta Predictions mouse pricing
XM_130033 Rosetta Predictions mouse pricing
XM_892079 Rosetta Predictions mouse pricing
XM_899907 Rosetta Predictions mouse pricing
XM_899964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038773 predicted 3265
2 SASI_Hs01_00038775 predicted 2381
3 SASI_Hs01_00038778 predicted 3573
4 SASI_Hs01_00038779 predicted 5764
5 SASI_Hs02_00354049 predicted 2032
6 SASI_Hs01_00038781 predicted 1633
7 SASI_Hs02_00354050 predicted 3581
8 SASI_Hs02_00354051 predicted 2679
9 SASI_Hs01_00038782 predicted 1300
10 SASI_Hs02_00354052 predicted 2860
11 SASI_Hs01_00038774 predicted 1840
12 SASI_Hs01_00038776 predicted 3929
13 SASI_Hs01_00038777 predicted 5521
14 SASI_Hs01_00038780 predicted 3398
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074395 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346070 predicted 3635
2 SASI_Rn02_00346071 predicted 2270
3 SASI_Rn02_00346072 predicted 3207
4 SASI_Rn02_00346073 predicted 1705
5 SASI_Rn02_00346074 predicted 1340
6 SASI_Rn02_00346075 predicted 559
7 SASI_Rn02_00346076 predicted 3611
8 SASI_Rn02_00346077 predicted 3118
9 SASI_Rn02_00346078 predicted 4516
10 SASI_Rn02_00346079 predicted 5440
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382974 predicted 3928
2 SASI_Rn02_00382975 predicted 2570
3 SASI_Rn02_00382976 predicted 3510
4 SASI_Rn02_00382977 predicted 2003
5 SASI_Rn02_00382978 predicted 1632
6 SASI_Rn02_00382979 predicted 854
7 SASI_Rn02_00382980 predicted 3908
8 SASI_Rn02_00382981 predicted 3411
9 SASI_Rn02_00382982 predicted 4809
10 SASI_Rn02_00382983 predicted 5736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297691 predicted 3134
2 SASI_Mm02_00297692 predicted 5601
3 SASI_Mm02_00297693 predicted 5381
4 SASI_Mm02_00297694 predicted 3616
5 SASI_Mm02_00297695 predicted 1532
6 SASI_Mm02_00297696 predicted 5462
7 SASI_Mm02_00297697 predicted 6221
8 SASI_Mm02_00297698 predicted 3273
9 SASI_Mm02_00297699 predicted 1497
10 SASI_Mm02_00297700 predicted 4435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310448 predicted 3166
2 SASI_Mm02_00310449 predicted 5627
3 SASI_Mm02_00310450 predicted 5407
4 SASI_Mm02_00310451 predicted 3647
5 SASI_Mm02_00310452 predicted 1557
6 SASI_Mm02_00310453 predicted 5492
7 SASI_Mm02_00310454 predicted 6243
8 SASI_Mm02_00310455 predicted 3296
9 SASI_Mm02_00310456 predicted 1527
10 SASI_Mm02_00310457 predicted 4467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269356 predicted 3539
2 SASI_Mm01_00269357 predicted 6001
3 SASI_Mm01_00269358 predicted 5782
4 SASI_Mm01_00269359 predicted 6144
5 SASI_Mm01_00269360 predicted 5864
6 SASI_Mm01_00269361 predicted 6614
7 SASI_Mm01_00269362 predicted 3671
8 SASI_Mm01_00269363 predicted 1891
9 SASI_Mm01_00269364 predicted 4842
10 SASI_Mm01_00269365 predicted 2296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210069 predicted 3604
2 SASI_Mm01_00210070 predicted 6074
3 SASI_Mm01_00210071 predicted 5850
4 SASI_Mm01_00210072 predicted 6221
5 SASI_Mm01_00210073 predicted 5935
6 SASI_Mm01_00210074 predicted 6694
7 SASI_Mm01_00210075 predicted 1210
8 SASI_Mm01_00210076 predicted 1963
9 SASI_Mm01_00210077 predicted 4910
10 SASI_Mm01_00210078 predicted 2366
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238228 predicted 1991
2 SASI_Mm01_00238229 predicted 1427
3 SASI_Mm01_00238230 predicted 1498
4 SASI_Mm01_00238231 predicted 1264
5 SASI_Mm01_00238232 predicted 960
6 SASI_Mm01_00238233 predicted 2001
7 SASI_Mm01_00238234 predicted 2445
8 SASI_Mm01_00238235 predicted 2401
9 SASI_Mm01_00238236 predicted 1216
10 SASI_Mm01_00238237 predicted 1966
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233221 predicted 2882
2 SASI_Mm01_00233222 predicted 5351
3 SASI_Mm01_00233223 predicted 5133
4 SASI_Mm01_00233224 predicted 5501
5 SASI_Mm01_00233225 predicted 5212
6 SASI_Mm01_00233226 predicted 5963
7 SASI_Mm01_00233227 predicted 3017
8 SASI_Mm01_00233228 predicted 1249
9 SASI_Mm01_00233229 predicted 4183
10 SASI_Mm01_00233230 predicted 1642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081364
VALIDATED
ARHGAP21 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-519s21c1
Sequence:CCGGTTACGACACTTCATCGTTTATCTCGAGATAAACGATGAAGTGTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-2624s21c1
Sequence:CCGGACGCAGAGAGGTCCATATAAACTCGAGTTTATATGGACCTCTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-867s21c1
Sequence:CCGGAGCGGCAATGCCCGTAATATACTCGAGTATATTACGGGCATTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-6311s21c1
Sequence:CCGGCCAGAAGAACACACGTATATACTCGAGTATATACGTGTGTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-5768s21c1
Sequence:CCGGTTCGGCTGTGAATCGGTTAAACTCGAGTTTAACCGATTCACAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081364
VALIDATED
ARHGAP21 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-519s21c1
Sequence:CCGGTTACGACACTTCATCGTTTATCTCGAGATAAACGATGAAGTGTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-2624s21c1
Sequence:CCGGACGCAGAGAGGTCCATATAAACTCGAGTTTATATGGACCTCTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-867s21c1
Sequence:CCGGAGCGGCAATGCCCGTAATATACTCGAGTATATTACGGGCATTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-6311s21c1
Sequence:CCGGCCAGAAGAACACACGTATATACTCGAGTATATACGTGTGTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-5768s21c1
Sequence:CCGGTTCGGCTGTGAATCGGTTAAACTCGAGTTTAACCGATTCACAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081364
VALIDATED
ARHGAP21 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-519s21c1
Sequence:CCGGTTACGACACTTCATCGTTTATCTCGAGATAAACGATGAAGTGTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-2624s21c1
Sequence:CCGGACGCAGAGAGGTCCATATAAACTCGAGTTTATATGGACCTCTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-867s21c1
Sequence:CCGGAGCGGCAATGCCCGTAATATACTCGAGTATATTACGGGCATTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-6311s21c1
Sequence:CCGGCCAGAAGAACACACGTATATACTCGAGTATATACGTGTGTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081364.3-5768s21c1
Sequence:CCGGTTCGGCTGTGAATCGGTTAAACTCGAGTTTAACCGATTCACAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020824
VALIDATED
ARHGAP21 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 21
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-2966s1c1
Sequence:CCGGCCTCACAACTTCAGCTCCATTCTCGAGAATGGAGCTGAAGTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-2286s1c1
Sequence:CCGGCTTGTGAAAGTCCGAAGTAATCTCGAGATTACTTCGGACTTTCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-6535s1c1
Sequence:CCGGGCAAGGTATTTGTTGCAACTTCTCGAGAAGTTGCAACAAATACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020824.2-4791s1c1
Sequence:CCGGGATACTAAAGAGGAGTCCAAACTCGAGTTTGGACTCCTCTTTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020824.2-6186s1c1
Sequence:CCGGCCTGACCAAATAAACGGAGAACTCGAGTTCTCCGTTTATTTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020824.2-6288s1c1
Sequence:CCGGGCAGAGTTTCATCCCTGTCTTCTCGAGAAGACAGGGATGAAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-1686s1c1
Sequence:CCGGGCATCTCAAAGCACGACAGATCTCGAGATCTGTCGTGCTTTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-1637s1c1
Sequence:CCGGGCACATAGGTTGTCGGACAATCTCGAGATTGTCCGACAACCTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020824
VALIDATED
ARHGAP21 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 21
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-2966s1c1
Sequence:CCGGCCTCACAACTTCAGCTCCATTCTCGAGAATGGAGCTGAAGTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-2286s1c1
Sequence:CCGGCTTGTGAAAGTCCGAAGTAATCTCGAGATTACTTCGGACTTTCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-6535s1c1
Sequence:CCGGGCAAGGTATTTGTTGCAACTTCTCGAGAAGTTGCAACAAATACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020824.2-4791s1c1
Sequence:CCGGGATACTAAAGAGGAGTCCAAACTCGAGTTTGGACTCCTCTTTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020824.2-6186s1c1
Sequence:CCGGCCTGACCAAATAAACGGAGAACTCGAGTTCTCCGTTTATTTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020824.2-6288s1c1
Sequence:CCGGGCAGAGTTTCATCCCTGTCTTCTCGAGAAGACAGGGATGAAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-1686s1c1
Sequence:CCGGGCATCTCAAAGCACGACAGATCTCGAGATCTGTCGTGCTTTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-1637s1c1
Sequence:CCGGGCACATAGGTTGTCGGACAATCTCGAGATTGTCCGACAACCTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020824
VALIDATED
ARHGAP21 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 21
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-2966s1c1
Sequence:CCGGCCTCACAACTTCAGCTCCATTCTCGAGAATGGAGCTGAAGTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-2286s1c1
Sequence:CCGGCTTGTGAAAGTCCGAAGTAATCTCGAGATTACTTCGGACTTTCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-6535s1c1
Sequence:CCGGGCAAGGTATTTGTTGCAACTTCTCGAGAAGTTGCAACAAATACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020824.2-4791s1c1
Sequence:CCGGGATACTAAAGAGGAGTCCAAACTCGAGTTTGGACTCCTCTTTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020824.2-6186s1c1
Sequence:CCGGCCTGACCAAATAAACGGAGAACTCGAGTTCTCCGTTTATTTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020824.2-6288s1c1
Sequence:CCGGGCAGAGTTTCATCCCTGTCTTCTCGAGAAGACAGGGATGAAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-1686s1c1
Sequence:CCGGGCATCTCAAAGCACGACAGATCTCGAGATCTGTCGTGCTTTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020824.2-1637s1c1
Sequence:CCGGGCACATAGGTTGTCGGACAATCTCGAGATTGTCCGACAACCTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks