EMAIL THIS PAGE TO A FRIEND

ARHGAP22

Rho GTPase activating protein 22

48 Gene Product Result for
Synonyms: RhoGAP2 RhoGap22
UniProtKB ID: Q7Z5H3, A0AVP7, A5YM75, B9EGA0, O00152, Q6ZSB0
Gene ID:
Human(58504) Summary: This gene encodes a member of the GTPase activating protein family which activates a GTPase belonging to the RAS superfamily of small GTP-binding proteins. The encoded protein is insulin-responsive, is dependent on the kinase Akt and requires the Akt-dependent 14-3-3 binding protein which binds sequentially to two serine residues. The result of these interactions is regulation of cell motility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(239027) Rho GTPase activating protein 22
Rat(306279) Rho GTPase activating protein 22
Zebrafish(562503) Rho GTPase activating protein 22
dog(100685787) Rho GTPase activating protein 22
domestic cat(101095047) Rho GTPase activating protein 22
cow(509022) Rho GTPase activating protein 22
Horse(100063193) Rho GTPase activating protein 22
chicken(423779) Rho GTPase activating protein 22
sheep(101116628) Rho GTPase activating protein 22
domestic guinea pig(100720863) Rho GTPase activating protein 22
naked mole-rat(101714898) Rho GTPase activating protein 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021226 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021226 Rosetta Predictions human pricing
NM_001107297 Rosetta Predictions rat pricing
NM_153800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166787 predicted 1147
2 SASI_Hs01_00166788 predicted 1169
3 SASI_Hs01_00166789 predicted 1179
4 SASI_Hs01_00166790 predicted 2449
5 SASI_Hs01_00166791 predicted 1267
6 SASI_Hs01_00166793 predicted 1112
7 SASI_Hs01_00166794 predicted 744
8 SASI_Hs01_00166795 predicted 1239
9 SASI_Hs01_00166796 predicted 1751
10 SASI_Hs02_00354848 predicted 2131
11 SASI_Hs01_00166792 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227455 predicted 985
2 SASI_Rn02_00227456 predicted 615
3 SASI_Rn02_00227457 predicted 741
4 SASI_Rn02_00227458 predicted 1088
5 SASI_Rn02_00227459 predicted 1469
6 SASI_Rn02_00227460 predicted 1128
7 SASI_Rn02_00227461 predicted 314
8 SASI_Rn02_00227462 predicted 1024
9 SASI_Rn02_00227463 predicted 1758
10 SASI_Rn02_00227464 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137559 predicted 993
2 SASI_Mm01_00137560 predicted 938
3 SASI_Mm01_00137561 predicted 1413
4 SASI_Mm01_00137562 predicted 1087
5 SASI_Mm01_00137563 predicted 597
6 SASI_Mm01_00137564 predicted 1526
7 SASI_Mm01_00137565 predicted 1487
8 SASI_Mm01_00137566 predicted 1591
9 SASI_Mm02_00343536 predicted 1402
10 SASI_Mm01_00137567 predicted 940
11 SASI_Mm01_00137568 predicted 1986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153800
ARHGAP22 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 22
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-1156s1c1
Sequence:CCGGGCATCTGATGACTGTCCTCATCTCGAGATGAGGACAGTCATCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-346s1c1
Sequence:CCGGGCTCTTCTACTACAAAGACAACTCGAGTTGTCTTTGTAGTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-959s1c1
Sequence:CCGGGCTAAACAAGTGAGCAACCTTCTCGAGAAGGTTGCTCACTTGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-1038s1c1
Sequence:CCGGCCCACTCAGATGTCAATAAGACTCGAGTCTTATTGACATCTGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-1106s1c1
Sequence:CCGGCCACAGATAGAGGATCCAGTACTCGAGTACTGGATCCTCTATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153800.2-1039s1c1
Sequence:CCGGCCACTCAGATGTCAATAAGATCTCGAGATCTTATTGACATCTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153800
ARHGAP22 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 22
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-1156s1c1
Sequence:CCGGGCATCTGATGACTGTCCTCATCTCGAGATGAGGACAGTCATCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-346s1c1
Sequence:CCGGGCTCTTCTACTACAAAGACAACTCGAGTTGTCTTTGTAGTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-959s1c1
Sequence:CCGGGCTAAACAAGTGAGCAACCTTCTCGAGAAGGTTGCTCACTTGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-1038s1c1
Sequence:CCGGCCCACTCAGATGTCAATAAGACTCGAGTCTTATTGACATCTGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-1106s1c1
Sequence:CCGGCCACAGATAGAGGATCCAGTACTCGAGTACTGGATCCTCTATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153800.2-1039s1c1
Sequence:CCGGCCACTCAGATGTCAATAAGATCTCGAGATCTTATTGACATCTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153800
ARHGAP22 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 22
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-1156s1c1
Sequence:CCGGGCATCTGATGACTGTCCTCATCTCGAGATGAGGACAGTCATCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-346s1c1
Sequence:CCGGGCTCTTCTACTACAAAGACAACTCGAGTTGTCTTTGTAGTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-959s1c1
Sequence:CCGGGCTAAACAAGTGAGCAACCTTCTCGAGAAGGTTGCTCACTTGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-1038s1c1
Sequence:CCGGCCCACTCAGATGTCAATAAGACTCGAGTCTTATTGACATCTGAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153800.2-1106s1c1
Sequence:CCGGCCACAGATAGAGGATCCAGTACTCGAGTACTGGATCCTCTATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153800.2-1039s1c1
Sequence:CCGGCCACTCAGATGTCAATAAGATCTCGAGATCTTATTGACATCTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021226
VALIDATED
ARHGAP22 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 22
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021226.2-1146s1c1
Sequence:CCGGGCTCAGATACATCTGCAAGTTCTCGAGAACTTGCAGATGTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021226.2-943s1c1
Sequence:CCGGCCACTGTTTGACAGCACAACACTCGAGTGTTGTGCTGTCAAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021226.2-2250s1c1
Sequence:CCGGGCTGGAAATAAAGCTGCGGAACTCGAGTTCCGCAGCTTTATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021226.2-529s1c1
Sequence:CCGGCAGGGATTTATTTCTCTACAACTCGAGTTGTAGAGAAATAAATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021226.2-2317s1c1
Sequence:CCGGCAGAGGGAAATGGAGGAGTTTCTCGAGAAACTCCTCCATTTCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021226.2-1119s21c1
Sequence:CCGGCAACCTTCCTCAGGCAAATTACTCGAGTAATTTGCCTGAGGAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021226.2-1199s21c1
Sequence:CCGGACAAGATGAGTGTCCAGAATCCTCGAGGATTCTGGACACTCATCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021226.2-1174s21c1
Sequence:CCGCGAAGTTCAGGCATACTCAAATCTCGAGATTTGAGTATGCCTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021226.2-2447s21c1
Sequence:CCGGATGGAGTTAGAAGCGTCTGTACTCGAGTACAGACGCTTCTAACTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021226.2-1760s21c1
Sequence:CCGGGACTCTCCACCTACGACAATGCTCGAGCATTGTCGTAGGTGGAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021226
VALIDATED
ARHGAP22 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 22
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021226.2-1146s1c1
Sequence:CCGGGCTCAGATACATCTGCAAGTTCTCGAGAACTTGCAGATGTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021226.2-943s1c1
Sequence:CCGGCCACTGTTTGACAGCACAACACTCGAGTGTTGTGCTGTCAAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021226.2-2250s1c1
Sequence:CCGGGCTGGAAATAAAGCTGCGGAACTCGAGTTCCGCAGCTTTATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021226.2-529s1c1
Sequence:CCGGCAGGGATTTATTTCTCTACAACTCGAGTTGTAGAGAAATAAATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021226.2-2317s1c1
Sequence:CCGGCAGAGGGAAATGGAGGAGTTTCTCGAGAAACTCCTCCATTTCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021226.2-1119s21c1
Sequence:CCGGCAACCTTCCTCAGGCAAATTACTCGAGTAATTTGCCTGAGGAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021226.2-1199s21c1
Sequence:CCGGACAAGATGAGTGTCCAGAATCCTCGAGGATTCTGGACACTCATCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021226.2-1174s21c1
Sequence:CCGCGAAGTTCAGGCATACTCAAATCTCGAGATTTGAGTATGCCTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021226.2-2447s21c1
Sequence:CCGGATGGAGTTAGAAGCGTCTGTACTCGAGTACAGACGCTTCTAACTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021226.2-1760s21c1
Sequence:CCGGGACTCTCCACCTACGACAATGCTCGAGCATTGTCGTAGGTGGAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021226
VALIDATED
ARHGAP22 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 22
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021226.2-1146s1c1
Sequence:CCGGGCTCAGATACATCTGCAAGTTCTCGAGAACTTGCAGATGTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021226.2-943s1c1
Sequence:CCGGCCACTGTTTGACAGCACAACACTCGAGTGTTGTGCTGTCAAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_021226.2-2250s1c1
Sequence:CCGGGCTGGAAATAAAGCTGCGGAACTCGAGTTCCGCAGCTTTATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021226.2-529s1c1
Sequence:CCGGCAGGGATTTATTTCTCTACAACTCGAGTTGTAGAGAAATAAATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021226.2-2317s1c1
Sequence:CCGGCAGAGGGAAATGGAGGAGTTTCTCGAGAAACTCCTCCATTTCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021226.2-1119s21c1
Sequence:CCGGCAACCTTCCTCAGGCAAATTACTCGAGTAATTTGCCTGAGGAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021226.2-1199s21c1
Sequence:CCGGACAAGATGAGTGTCCAGAATCCTCGAGGATTCTGGACACTCATCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021226.2-1174s21c1
Sequence:CCGCGAAGTTCAGGCATACTCAAATCTCGAGATTTGAGTATGCCTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021226.2-2447s21c1
Sequence:CCGGATGGAGTTAGAAGCGTCTGTACTCGAGTACAGACGCTTCTAACTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021226.2-1760s21c1
Sequence:CCGGGACTCTCCACCTACGACAATGCTCGAGCATTGTCGTAGGTGGAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks