EMAIL THIS PAGE TO A FRIEND

ARHGAP23

Rho GTPase activating protein 23

102 Gene Product Result for
UniProtKB ID: Q9P227
Gene ID:
Human(57636) Summary: The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]
Mouse(58996) Rho GTPase activating protein 23
Rat(303501) Rho GTPase activating protein 23
cow(523030) Rho GTPase activating protein 23
dog(491038) Rho GTPase activating protein 23
domestic cat(101099089) Rho GTPase activating protein 23
naked mole-rat(101724497) Rho GTPase activating protein 23
domestic guinea pig(100724916) Rho GTPase activating protein 23
sheep(101123648) Rho GTPase activating protein 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020876 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_290799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290799 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU068311 MISSION® esiRNA esiRNA targeting mouse Arhgap23 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714948 Rosetta Predictions human pricing
XM_001716606 Rosetta Predictions human pricing
XM_290799 Rosetta Predictions human pricing
XM_930977 Rosetta Predictions human pricing
XM_001081375 Rosetta Predictions rat pricing
XM_220918 Rosetta Predictions rat pricing
NM_021493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00400468 predicted 1894
2 SASI_Hs02_00400469 predicted 532
3 SASI_Hs02_00400470 predicted 3546
4 SASI_Hs02_00400471 predicted 3163
5 SASI_Hs02_00400472 predicted 1651
6 SASI_Hs02_00400473 predicted 535
7 SASI_Hs02_00400474 predicted 1655
8 SASI_Hs02_00400475 predicted 2005
9 SASI_Hs02_00400476 predicted 3385
10 SASI_Hs02_00400477 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00411670 predicted 1752
2 SASI_Hs02_00411671 predicted 385
3 SASI_Hs02_00411672 predicted 3395
4 SASI_Hs02_00411673 predicted 3021
5 SASI_Hs02_00411674 predicted 1498
6 SASI_Hs02_00411675 predicted 392
7 SASI_Hs02_00411676 predicted 1516
8 SASI_Hs02_00411677 predicted 1860
9 SASI_Hs02_00411678 predicted 3247
10 SASI_Hs02_00411679 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284820 predicted 1710
2 SASI_Hs01_00284821 predicted 2977
3 SASI_Hs02_00479022 predicted 343
4 SASI_Hs01_00284819 predicted 3352
5 SASI_Hs02_00479023 predicted 1460
6 SASI_Hs02_00479024 predicted 351
7 SASI_Hs02_00479025 predicted 1464
8 SASI_Hs02_00479026 predicted 1816
9 SASI_Hs02_00479027 predicted 3204
10 SASI_Hs02_00479028 predicted 1339
11 SASI_Hs01_00284816 predicted 2597
12 SASI_Hs01_00284817 predicted 2378
13 SASI_Hs01_00284818 predicted 2574
14 SASI_Hs01_00284822 predicted 570
15 SASI_Hs01_00284823 predicted 2542
16 SASI_Hs01_00284824 predicted 558
17 SASI_Hs01_00284825 predicted 2509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259572 predicted 1242
2 SASI_Hs01_00259573 predicted 824
3 SASI_Hs01_00259574 predicted 1011
4 SASI_Hs01_00259575 predicted 2508
5 SASI_Hs01_00259576 predicted 790
6 SASI_Hs01_00259577 predicted 989
7 SASI_Hs01_00259578 predicted 1027
8 SASI_Hs01_00259579 predicted 2003
9 SASI_Hs01_00259580 predicted 664
10 SASI_Hs01_00259581 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371633 predicted 4121
2 SASI_Rn02_00371634 predicted 3192
3 SASI_Rn02_00371635 predicted 3176
4 SASI_Rn02_00371636 predicted 2529
5 SASI_Rn02_00371637 predicted 1014
6 SASI_Rn02_00371638 predicted 2990
7 SASI_Rn02_00371639 predicted 692
8 SASI_Rn02_00371640 predicted 3036
9 SASI_Rn02_00371641 predicted 1557
10 SASI_Rn02_00371642 predicted 2539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379649 predicted 4767
2 SASI_Rn02_00379650 predicted 3828
3 SASI_Rn02_00379651 predicted 3762
4 SASI_Rn02_00379652 predicted 3813
5 SASI_Rn02_00379653 predicted 3166
6 SASI_Rn02_00379654 predicted 1020
7 SASI_Rn02_00379655 predicted 3633
8 SASI_Rn02_00379656 predicted 698
9 SASI_Rn02_00379657 predicted 3678
10 SASI_Rn02_00379658 predicted 2205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326188 predicted 1375
2 SASI_Mm02_00326189 predicted 2177
3 SASI_Mm02_00326190 predicted 964
4 SASI_Mm02_00326191 predicted 2180
5 SASI_Mm02_00326192 predicted 2781
6 SASI_Mm02_00326193 predicted 2823
7 SASI_Mm01_00196557 predicted 4196
8 SASI_Mm02_00326194 predicted 2969
9 SASI_Mm02_00326195 predicted 3082
10 SASI_Mm02_00326196 predicted 1232
11 SASI_Mm01_00196555 predicted 988
12 SASI_Mm01_00196556 predicted 256
13 SASI_Mm01_00196558 predicted 235
14 SASI_Mm01_00196559 predicted 653
15 SASI_Mm01_00196560 predicted 1707
16 SASI_Mm01_00196561 predicted 1588
17 SASI_Mm01_00196562 predicted 1336
18 SASI_Mm01_00196563 predicted 2191
19 SASI_Mm01_00196564 predicted 2327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020876
ARHGAP23 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 23
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000430926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020876.1-2427s21c1
Sequence:CCGGGATGCGACCTTCAGCGATATCCTCGAGGATATCGCTGAAGGTCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020876.1-887s21c1
Sequence:CCGGGAAAGGGAACGAGCCGTATTCCTCGAGGAATACGGCTCGTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020876
ARHGAP23 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 23
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000430926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020876.1-2427s21c1
Sequence:CCGGGATGCGACCTTCAGCGATATCCTCGAGGATATCGCTGAAGGTCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020876.1-887s21c1
Sequence:CCGGGAAAGGGAACGAGCCGTATTCCTCGAGGAATACGGCTCGTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020876
ARHGAP23 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 23
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000430926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020876.1-2427s21c1
Sequence:CCGGGATGCGACCTTCAGCGATATCCTCGAGGATATCGCTGAAGGTCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020876.1-887s21c1
Sequence:CCGGGAAAGGGAACGAGCCGTATTCCTCGAGGAATACGGCTCGTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021493
VALIDATED
ARHGAP23 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 23
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021493.2-1337s1c1
Sequence:CCGGGCTGGCTTCTATTCCCTTTATCTCGAGATAAAGGGAATAGAAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021493.2-1758s1c1
Sequence:CCGGGATGCAACCTTCAGTGATATCCTCGAGGATATCACTGAAGGTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021493.2-965s21c1
Sequence:CCGGCATTGGATATCGGAGCTATAGCTCGAGCTATAGCTCCGATATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021493.2-2789s21c1
Sequence:CCGGACACTACTATGAAACACTTAACTCGAGTTAAGTGTTTCATAGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021493.2-3073s21c1
Sequence:CCGGAGTACCTCCTGCCCAACATTGCTCGAGCAATGTTGGGCAGGAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021493.2-2172s21c1
Sequence:CCGGCTGATCAGCAAGAAGCTTAATCTCGAGATTAAGCTTCTTGCTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021493.2-4198s21c1
Sequence:CCGGGCAGAAATTCCCGTCTCGTTTCTCGAGAAACGAGACGGGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021493.1-991s1c1
Sequence:CCGGCCTCAACTTCAACGAGTGGAACTCGAGTTCCACTCGTTGAAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021493.1-1233s1c1
Sequence:CCGGGCAGAAATTCCCGTCTCGTTTCTCGAGAAACGAGACGGGAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021493.1-643s1c1
Sequence:CCGGCTTCAGCTCACACCATCTCATCTCGAGATGAGATGGTGTGAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021493.1-994s1c1
Sequence:CCGGCAACTTCAACGAGTGGAAGGACTCGAGTCCTTCCACTCGTTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021493.1-1058s1c1
Sequence:CCGGCACAGCGACAATAAGGACTCTCTCGAGAGAGTCCTTATTGTCGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021493.1-2236s1c1
Sequence:CCGGCCCTCCCTTTCACTGTAAATACTCGAGTATTTACAGTGAAAGGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021493.1-1497s1c1
Sequence:CCGGCCAAGTTTCATACAGAAGGAACTCGAGTTCCTTCTGTATGAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021493
VALIDATED
ARHGAP23 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 23
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021493.2-1337s1c1
Sequence:CCGGGCTGGCTTCTATTCCCTTTATCTCGAGATAAAGGGAATAGAAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021493.2-1758s1c1
Sequence:CCGGGATGCAACCTTCAGTGATATCCTCGAGGATATCACTGAAGGTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021493.2-965s21c1
Sequence:CCGGCATTGGATATCGGAGCTATAGCTCGAGCTATAGCTCCGATATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021493.2-2789s21c1
Sequence:CCGGACACTACTATGAAACACTTAACTCGAGTTAAGTGTTTCATAGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021493.2-3073s21c1
Sequence:CCGGAGTACCTCCTGCCCAACATTGCTCGAGCAATGTTGGGCAGGAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021493.2-2172s21c1
Sequence:CCGGCTGATCAGCAAGAAGCTTAATCTCGAGATTAAGCTTCTTGCTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021493.2-4198s21c1
Sequence:CCGGGCAGAAATTCCCGTCTCGTTTCTCGAGAAACGAGACGGGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021493.1-991s1c1
Sequence:CCGGCCTCAACTTCAACGAGTGGAACTCGAGTTCCACTCGTTGAAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021493.1-1233s1c1
Sequence:CCGGGCAGAAATTCCCGTCTCGTTTCTCGAGAAACGAGACGGGAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021493.1-643s1c1
Sequence:CCGGCTTCAGCTCACACCATCTCATCTCGAGATGAGATGGTGTGAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021493.1-994s1c1
Sequence:CCGGCAACTTCAACGAGTGGAAGGACTCGAGTCCTTCCACTCGTTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021493.1-1058s1c1
Sequence:CCGGCACAGCGACAATAAGGACTCTCTCGAGAGAGTCCTTATTGTCGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021493.1-2236s1c1
Sequence:CCGGCCCTCCCTTTCACTGTAAATACTCGAGTATTTACAGTGAAAGGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021493.1-1497s1c1
Sequence:CCGGCCAAGTTTCATACAGAAGGAACTCGAGTTCCTTCTGTATGAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021493
VALIDATED
ARHGAP23 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 23
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021493.2-1337s1c1
Sequence:CCGGGCTGGCTTCTATTCCCTTTATCTCGAGATAAAGGGAATAGAAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021493.2-1758s1c1
Sequence:CCGGGATGCAACCTTCAGTGATATCCTCGAGGATATCACTGAAGGTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021493.2-965s21c1
Sequence:CCGGCATTGGATATCGGAGCTATAGCTCGAGCTATAGCTCCGATATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021493.2-2789s21c1
Sequence:CCGGACACTACTATGAAACACTTAACTCGAGTTAAGTGTTTCATAGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021493.2-3073s21c1
Sequence:CCGGAGTACCTCCTGCCCAACATTGCTCGAGCAATGTTGGGCAGGAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021493.2-2172s21c1
Sequence:CCGGCTGATCAGCAAGAAGCTTAATCTCGAGATTAAGCTTCTTGCTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021493.2-4198s21c1
Sequence:CCGGGCAGAAATTCCCGTCTCGTTTCTCGAGAAACGAGACGGGAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021493.1-991s1c1
Sequence:CCGGCCTCAACTTCAACGAGTGGAACTCGAGTTCCACTCGTTGAAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021493.1-1233s1c1
Sequence:CCGGGCAGAAATTCCCGTCTCGTTTCTCGAGAAACGAGACGGGAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021493.1-643s1c1
Sequence:CCGGCTTCAGCTCACACCATCTCATCTCGAGATGAGATGGTGTGAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021493.1-994s1c1
Sequence:CCGGCAACTTCAACGAGTGGAAGGACTCGAGTCCTTCCACTCGTTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021493.1-1058s1c1
Sequence:CCGGCACAGCGACAATAAGGACTCTCTCGAGAGAGTCCTTATTGTCGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021493.1-2236s1c1
Sequence:CCGGCCCTCCCTTTCACTGTAAATACTCGAGTATTTACAGTGAAAGGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021493.1-1497s1c1
Sequence:CCGGCCAAGTTTCATACAGAAGGAACTCGAGTTCCTTCTGTATGAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290799
VALIDATED
ARHGAP23 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 23
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-4707s1c1
Sequence:CCGGCCTCAACTTCAACGAGTGGAACTCGAGTTCCACTCGTTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-1978s1c1
Sequence:CCGGAGACAGATGAACCTTGGATTTCTCGAGAAATCCAAGGTTCATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-871s1c1
Sequence:CCGGGCTCTGATCCAGAATAGTGATCTCGAGATCACTATTCTGGATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-1716s1c1
Sequence:CCGGCCGGAGCTACAGCCCATCATTCTCGAGAATGATGGGCTGTAGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-634s1c1
Sequence:CCGGCGCCACTTCATCGTGTACCCACTCGAGTGGGTACACGATGAAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290799
VALIDATED
ARHGAP23 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 23
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-4707s1c1
Sequence:CCGGCCTCAACTTCAACGAGTGGAACTCGAGTTCCACTCGTTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-1978s1c1
Sequence:CCGGAGACAGATGAACCTTGGATTTCTCGAGAAATCCAAGGTTCATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-871s1c1
Sequence:CCGGGCTCTGATCCAGAATAGTGATCTCGAGATCACTATTCTGGATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-1716s1c1
Sequence:CCGGCCGGAGCTACAGCCCATCATTCTCGAGAATGATGGGCTGTAGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-634s1c1
Sequence:CCGGCGCCACTTCATCGTGTACCCACTCGAGTGGGTACACGATGAAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290799
VALIDATED
ARHGAP23 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 23
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-4707s1c1
Sequence:CCGGCCTCAACTTCAACGAGTGGAACTCGAGTTCCACTCGTTGAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-1978s1c1
Sequence:CCGGAGACAGATGAACCTTGGATTTCTCGAGAAATCCAAGGTTCATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-871s1c1
Sequence:CCGGGCTCTGATCCAGAATAGTGATCTCGAGATCACTATTCTGGATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-1716s1c1
Sequence:CCGGCCGGAGCTACAGCCCATCATTCTCGAGAATGATGGGCTGTAGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_290799.4-634s1c1
Sequence:CCGGCGCCACTTCATCGTGTACCCACTCGAGTGGGTACACGATGAAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks