EMAIL THIS PAGE TO A FRIEND

ARHGAP24

Rho GTPase activating protein 24

158 Gene Product Result for
Synonyms: FILGAP RC-GAP72 RCGAP72 p73 p73RhoGAP
UniProtKB ID: Q8N264, Q4KMG1, Q6ZNV3, Q86TI5, Q86WE4, Q9H0T6
Gene ID:
Human(83478) Summary: ARHGAPs, such as ARHGAP24, encode negative regulators of Rho GTPases (see ARHA; MIM 165390), which are implicated in actin remodeling, cell polarity, and cell migration (Katoh and Katoh, 2004 [PubMed 15254788]
Mouse(231532) Rho GTPase activating protein 24
Rat(305156) Rho GTPase activating protein 24
Zebrafish(100005116) Rho GTPase activating protein 24
cow(539902) Rho GTPase activating protein 24
Horse(100052555) Rho GTPase activating protein 24
domestic cat(101080454) Rho GTPase activating protein 24
dog(478463) Rho GTPase activating protein 24
chicken(422593) Rho GTPase activating protein 24
sheep(101119904) Rho GTPase activating protein 24
domestic guinea pig(100719872) Rho GTPase activating protein 24
naked mole-rat(101709855) Rho GTPase activating protein 24
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025616 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031305 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025616 Rosetta Predictions human pricing
NM_001042669 Rosetta Predictions human pricing
NM_031305 Rosetta Predictions human pricing
NM_001012032 Rosetta Predictions rat pricing
XM_573555 Rosetta Predictions rat pricing
NM_029270 Rosetta Predictions mouse pricing
NM_146161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232267 predicted 2062
2 SASI_Hs02_00307480 predicted 2546
3 SASI_Hs01_00232268 predicted 1089
4 SASI_Hs02_00307481 predicted 2007
5 SASI_Hs01_00232270 predicted 1206
6 SASI_Hs01_00232271 predicted 1172
7 SASI_Hs02_00307482 predicted 2414
8 SASI_Hs01_00232272 predicted 1101
9 SASI_Hs02_00307483 predicted 1665
10 SASI_Hs02_00307484 predicted 2745
11 SASI_Hs01_00232269 predicted 2025
12 SASI_Hs01_00232273 predicted 1191
13 SASI_Hs01_00232274 predicted 2024
14 SASI_Hs01_00232275 predicted 2309
15 SASI_Hs01_00232276 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310913 predicted 1616
2 SASI_Hs02_00310914 predicted 2104
3 SASI_Hs02_00310915 predicted 647
4 SASI_Hs02_00310916 predicted 1558
5 SASI_Hs02_00310917 predicted 756
6 SASI_Hs02_00310918 predicted 726
7 SASI_Hs02_00310919 predicted 1960
8 SASI_Hs02_00310920 predicted 655
9 SASI_Hs02_00310921 predicted 1214
10 SASI_Hs02_00310922 predicted 2298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067634 predicted 1990
2 SASI_Hs02_00358750 predicted 2476
3 SASI_Hs01_00067635 predicted 1021
4 SASI_Hs02_00358751 predicted 1931
5 SASI_Hs01_00067637 predicted 1131
6 SASI_Hs01_00067638 predicted 1110
7 SASI_Hs02_00358752 predicted 2340
8 SASI_Hs01_00067639 predicted 1032
9 SASI_Hs02_00358753 predicted 1595
10 SASI_Hs02_00358754 predicted 2681
11 SASI_Hs01_00067636 predicted 1968
12 SASI_Hs01_00067640 predicted 1142
13 SASI_Hs01_00067641 predicted 1979
14 SASI_Hs01_00067642 predicted 2256
15 SASI_Hs01_00067643 predicted 1697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102015 predicted 803
2 SASI_Rn01_00102016 predicted 845
3 SASI_Rn02_00200128 predicted 612
4 SASI_Rn01_00102017 predicted 2002
5 SASI_Rn01_00102018 predicted 346
6 SASI_Rn01_00102019 predicted 721
7 SASI_Rn02_00200129 predicted 1740
8 SASI_Rn01_00102020 predicted 1958
9 SASI_Rn01_00102023 predicted 1727
10 SASI_Rn01_00102024 predicted 741
11 SASI_Rn01_00102021 predicted 1469
12 SASI_Rn01_00102022 predicted 2124
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147074 predicted 933
2 SASI_Rn01_00147075 predicted 922
3 SASI_Rn01_00147076 predicted 835
4 SASI_Rn01_00147077 predicted 825
5 SASI_Rn01_00147078 predicted 846
6 SASI_Rn01_00147079 predicted 771
7 SASI_Rn01_00147080 predicted 891
8 SASI_Rn01_00147081 predicted 859
9 SASI_Rn01_00147082 predicted 856
10 SASI_Rn01_00147083 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107477 predicted 1303
2 SASI_Mm02_00335048 predicted 1223
3 SASI_Mm01_00107478 predicted 2001
4 SASI_Mm01_00107479 predicted 2363
5 SASI_Mm01_00107480 predicted 2229
6 SASI_Mm01_00107482 predicted 2459
7 SASI_Mm01_00107483 predicted 2241
8 SASI_Mm02_00335049 predicted 1218
9 SASI_Mm02_00335050 predicted 1059
10 SASI_Mm01_00107485 predicted 1881
11 SASI_Mm01_00107476 predicted 1710
12 SASI_Mm01_00107481 predicted 2572
13 SASI_Mm01_00107484 predicted 2171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190465 predicted 1113
2 SASI_Mm02_00341855 predicted 1026
3 SASI_Mm01_00190466 predicted 1811
4 SASI_Mm01_00190467 predicted 2170
5 SASI_Mm01_00190468 predicted 2033
6 SASI_Mm01_00190470 predicted 2267
7 SASI_Mm01_00190471 predicted 2043
8 SASI_Mm02_00341856 predicted 1015
9 SASI_Mm02_00341857 predicted 865
10 SASI_Mm01_00190473 predicted 1684
11 SASI_Mm01_00190464 predicted 1358
12 SASI_Mm01_00190469 predicted 2224
13 SASI_Mm01_00190472 predicted 1827
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025616
ARHGAP24 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 24
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000179969    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025616.1-2765s1c1
Sequence:CCGGCCTGGATGTACAGAAGTCTAACTCGAGTTAGACTTCTGTACATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025616
ARHGAP24 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 24
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000179969    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025616.1-2765s1c1
Sequence:CCGGCCTGGATGTACAGAAGTCTAACTCGAGTTAGACTTCTGTACATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025616
ARHGAP24 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 24
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000179969    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025616.1-2765s1c1
Sequence:CCGGCCTGGATGTACAGAAGTCTAACTCGAGTTAGACTTCTGTACATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031305
VALIDATED
ARHGAP24 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 24
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031305.1-857s1c1
Sequence:CCGGGCGTGGACTTTATCCGACAAACTCGAGTTTGTCGGATAAAGTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031305.1-1911s1c1
Sequence:CCGGCCTGAGGGATAACAAGCAGAACTCGAGTTCTGCTTGTTATCCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031305.1-1323s1c1
Sequence:CCGGCCAGCAGTTGATGTCAGTGATCTCGAGATCACTGACATCAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031305.1-1246s1c1
Sequence:CCGGGCAACGGTCTTTGGTCCTAATCTCGAGATTAGGACCAAAGACCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031305.1-2597s1c1
Sequence:CCGGCCGAGAGAGGAAACACAATATCTCGAGATATTGTGTTTCCTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031305
VALIDATED
ARHGAP24 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 24
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031305.1-857s1c1
Sequence:CCGGGCGTGGACTTTATCCGACAAACTCGAGTTTGTCGGATAAAGTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031305.1-1911s1c1
Sequence:CCGGCCTGAGGGATAACAAGCAGAACTCGAGTTCTGCTTGTTATCCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031305.1-1323s1c1
Sequence:CCGGCCAGCAGTTGATGTCAGTGATCTCGAGATCACTGACATCAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031305.1-1246s1c1
Sequence:CCGGGCAACGGTCTTTGGTCCTAATCTCGAGATTAGGACCAAAGACCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031305.1-2597s1c1
Sequence:CCGGCCGAGAGAGGAAACACAATATCTCGAGATATTGTGTTTCCTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031305
VALIDATED
ARHGAP24 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 24
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031305.1-857s1c1
Sequence:CCGGGCGTGGACTTTATCCGACAAACTCGAGTTTGTCGGATAAAGTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031305.1-1911s1c1
Sequence:CCGGCCTGAGGGATAACAAGCAGAACTCGAGTTCTGCTTGTTATCCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031305.1-1323s1c1
Sequence:CCGGCCAGCAGTTGATGTCAGTGATCTCGAGATCACTGACATCAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031305.1-1246s1c1
Sequence:CCGGGCAACGGTCTTTGGTCCTAATCTCGAGATTAGGACCAAAGACCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031305.1-2597s1c1
Sequence:CCGGCCGAGAGAGGAAACACAATATCTCGAGATATTGTGTTTCCTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146161
VALIDATED
ARHGAP24 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 24
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146161.1-963s1c1
Sequence:CCGGGCAGTCCTATTCAGGAGTTAACTCGAGTTAACTCCTGAATAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146161.1-1350s1c1
Sequence:CCGGCCCAAGGAACAGTATCCACAACTCGAGTTGTGGATACTGTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146161.1-804s1c1
Sequence:CCGGCGTCGTTCCTTATGCAAAGTACTCGAGTACTTTGCATAAGGAACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146161.1-2124s1c1
Sequence:CCGGCGAGTATGAGTCCAGGATAAACTCGAGTTTATCCTGGACTCATACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146161.1-1083s1c1
Sequence:CCGGCCAGCAGTTAATGTCAGTGATCTCGAGATCACTGACATTAACTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146161.3-2789s21c1
Sequence:CCGGTAAGAGTAAGAAGCATATATCCTCGAGGATATATGCTTCTTACTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146161.3-2174s21c1
Sequence:CCGGAGCGATAACAGCGAGACATTCCTCGAGGAATGTCTCGCTGTTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146161.3-645s21c1
Sequence:CCGGAGTCCATCCGCCGAGTCATATCTCGAGATATGACTCGGCGGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146161
VALIDATED
ARHGAP24 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 24
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146161.1-963s1c1
Sequence:CCGGGCAGTCCTATTCAGGAGTTAACTCGAGTTAACTCCTGAATAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146161.1-1350s1c1
Sequence:CCGGCCCAAGGAACAGTATCCACAACTCGAGTTGTGGATACTGTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146161.1-804s1c1
Sequence:CCGGCGTCGTTCCTTATGCAAAGTACTCGAGTACTTTGCATAAGGAACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146161.1-2124s1c1
Sequence:CCGGCGAGTATGAGTCCAGGATAAACTCGAGTTTATCCTGGACTCATACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146161.1-1083s1c1
Sequence:CCGGCCAGCAGTTAATGTCAGTGATCTCGAGATCACTGACATTAACTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146161.3-2789s21c1
Sequence:CCGGTAAGAGTAAGAAGCATATATCCTCGAGGATATATGCTTCTTACTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146161.3-2174s21c1
Sequence:CCGGAGCGATAACAGCGAGACATTCCTCGAGGAATGTCTCGCTGTTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146161.3-645s21c1
Sequence:CCGGAGTCCATCCGCCGAGTCATATCTCGAGATATGACTCGGCGGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146161
VALIDATED
ARHGAP24 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 24
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146161.1-963s1c1
Sequence:CCGGGCAGTCCTATTCAGGAGTTAACTCGAGTTAACTCCTGAATAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146161.1-1350s1c1
Sequence:CCGGCCCAAGGAACAGTATCCACAACTCGAGTTGTGGATACTGTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146161.1-804s1c1
Sequence:CCGGCGTCGTTCCTTATGCAAAGTACTCGAGTACTTTGCATAAGGAACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146161.1-2124s1c1
Sequence:CCGGCGAGTATGAGTCCAGGATAAACTCGAGTTTATCCTGGACTCATACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146161.1-1083s1c1
Sequence:CCGGCCAGCAGTTAATGTCAGTGATCTCGAGATCACTGACATTAACTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146161.3-2789s21c1
Sequence:CCGGTAAGAGTAAGAAGCATATATCCTCGAGGATATATGCTTCTTACTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146161.3-2174s21c1
Sequence:CCGGAGCGATAACAGCGAGACATTCCTCGAGGAATGTCTCGCTGTTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146161.3-645s21c1
Sequence:CCGGAGTCCATCCGCCGAGTCATATCTCGAGATATGACTCGGCGGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks