EMAIL THIS PAGE TO A FRIEND

ARHGAP25

Rho GTPase activating protein 25

Synonyms: KAIA0053
UniProtKB ID: P42331, A8K2Y1, B7Z498, E9PFQ7, G5E9G2, Q8IXQ2
Gene ID:
Human(9938) Summary: ARHGAPs, such as ARHGAP25, encode negative regulators of Rho GTPases (see ARHA; MIM 165390), which are implicated in actin remodeling, cell polarity, and cell migration (Katoh and Katoh, 2004 [PubMed 15254788]
Mouse(232201) Rho GTPase activating protein 25
Rat(500246) Rho GTPase activating protein 25
naked mole-rat(101703252) Rho GTPase activating protein 25
domestic guinea pig(100721324) Rho GTPase activating protein 25
sheep(101109429) Rho GTPase activating protein 25
Domestic Rabbit(100342019) Rho GTPase activating protein 25
Zebrafish(562468) Rho GTPase activating protein 25
cow(534994) Rho GTPase activating protein 25
domestic cat(101092263) Rho GTPase activating protein 25
dog(481407) Rho GTPase activating protein 25
chicken(419516) Rho GTPase activating protein 25
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_376060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376060 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054381 MISSION® esiRNA esiRNA human ARHGAP25 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007231 Rosetta Predictions human pricing
NM_014882 Rosetta Predictions human pricing
NM_001109247 Rosetta Predictions rat pricing
NM_001037727 Rosetta Predictions mouse pricing
NM_175476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099972 predicted 823
2 SASI_Hs01_00099973 predicted 1947
3 SASI_Hs01_00099974 predicted 2071
4 SASI_Hs01_00099975 predicted 2225
5 SASI_Hs01_00099976 predicted 2053
6 SASI_Hs01_00099977 predicted 1379
7 SASI_Hs01_00099978 predicted 2292
8 SASI_Hs01_00099979 predicted 2038
9 SASI_Hs01_00099980 predicted 2232
10 SASI_Hs01_00099981 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225464 predicted 819
2 SASI_Hs01_00225465 predicted 1937
3 SASI_Hs01_00225466 predicted 2065
4 SASI_Hs01_00225467 predicted 2222
5 SASI_Hs01_00225468 predicted 2048
6 SASI_Hs01_00225469 predicted 1375
7 SASI_Hs01_00225470 predicted 2291
8 SASI_Hs01_00225471 predicted 2030
9 SASI_Hs01_00225472 predicted 2221
10 SASI_Hs01_00225473 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246534 predicted 2188
2 SASI_Rn02_00246535 predicted 1748
3 SASI_Rn02_00246536 predicted 496
4 SASI_Rn02_00246537 predicted 2084
5 SASI_Rn02_00246538 predicted 2075
6 SASI_Rn02_00246539 predicted 2188
7 SASI_Rn02_00246540 predicted 1564
8 SASI_Rn02_00246541 predicted 1271
9 SASI_Rn02_00246542 predicted 2310
10 SASI_Rn02_00246543 predicted 2305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180614 predicted 1836
2 SASI_Mm01_00180615 predicted 2158
3 SASI_Mm01_00180616 predicted 2312
4 SASI_Mm01_00180617 predicted 2056
5 SASI_Mm01_00180618 predicted 2268
6 SASI_Mm01_00180619 predicted 1798
7 SASI_Mm01_00180620 predicted 1249
8 SASI_Mm02_00289375 predicted 1010
9 SASI_Mm01_00180622 predicted 1724
10 SASI_Mm01_00180623 predicted 2110
11 SASI_Mm01_00180621 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195173 predicted 1510
2 SASI_Mm01_00195174 predicted 1835
3 SASI_Mm01_00195175 predicted 1987
4 SASI_Mm01_00195176 predicted 1717
5 SASI_Mm01_00195177 predicted 1937
6 SASI_Mm01_00195178 predicted 1462
7 SASI_Mm01_00195179 predicted 915
8 SASI_Mm02_00346388 predicted 674
9 SASI_Mm01_00195181 predicted 1395
10 SASI_Mm01_00195182 predicted 1776
11 SASI_Mm01_00195180 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175476
ARHGAP25 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 25
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175476.2-2481s1c1
Sequence:CCGGGCAAGGATATTGGCAATCTAACTCGAGTTAGATTGCCAATATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175476.2-1018s1c1
Sequence:CCGGGATCCAAAGAGTGATGACCATCTCGAGATGGTCATCACTCTTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175476.2-1498s1c1
Sequence:CCGGGCGGACTTCTACCTACGATAACTCGAGTTATCGTAGGTAGAAGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175476.2-1595s1c1
Sequence:CCGGGCTCTTGTTAGCACAGACTCTCTCGAGAGAGTCTGTGCTAACAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175476
ARHGAP25 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 25
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175476.2-2481s1c1
Sequence:CCGGGCAAGGATATTGGCAATCTAACTCGAGTTAGATTGCCAATATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175476.2-1018s1c1
Sequence:CCGGGATCCAAAGAGTGATGACCATCTCGAGATGGTCATCACTCTTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175476.2-1498s1c1
Sequence:CCGGGCGGACTTCTACCTACGATAACTCGAGTTATCGTAGGTAGAAGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175476.2-1595s1c1
Sequence:CCGGGCTCTTGTTAGCACAGACTCTCTCGAGAGAGTCTGTGCTAACAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175476
ARHGAP25 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 25
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175476.2-2481s1c1
Sequence:CCGGGCAAGGATATTGGCAATCTAACTCGAGTTAGATTGCCAATATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175476.2-1018s1c1
Sequence:CCGGGATCCAAAGAGTGATGACCATCTCGAGATGGTCATCACTCTTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175476.2-1498s1c1
Sequence:CCGGGCGGACTTCTACCTACGATAACTCGAGTTATCGTAGGTAGAAGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175476.2-1595s1c1
Sequence:CCGGGCTCTTGTTAGCACAGACTCTCTCGAGAGAGTCTGTGCTAACAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376060
ARHGAP25 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 25
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-685s1c1
Sequence:CCGGGCATGTATCTACCAGGATGTACTCGAGTACATCCTGGTAGATACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-1684s1c1
Sequence:CCGGGCAGCAAAGTACCCAGGGAAACTCGAGTTTCCCTGGGTACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-2093s1c1
Sequence:CCGGCCAAGAGCTACGAAAGGAAATCTCGAGATTTCCTTTCGTAGCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-1304s1c1
Sequence:CCGGCCTACATGAAATACAGCTGAACTCGAGTTCAGCTGTATTTCATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-738s1c1
Sequence:CCGGGCTGGGAAGTTTGTCTTTGAACTCGAGTTCAAAGACAAACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376060
ARHGAP25 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 25
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-685s1c1
Sequence:CCGGGCATGTATCTACCAGGATGTACTCGAGTACATCCTGGTAGATACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-1684s1c1
Sequence:CCGGGCAGCAAAGTACCCAGGGAAACTCGAGTTTCCCTGGGTACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-2093s1c1
Sequence:CCGGCCAAGAGCTACGAAAGGAAATCTCGAGATTTCCTTTCGTAGCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-1304s1c1
Sequence:CCGGCCTACATGAAATACAGCTGAACTCGAGTTCAGCTGTATTTCATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-738s1c1
Sequence:CCGGGCTGGGAAGTTTGTCTTTGAACTCGAGTTCAAAGACAAACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376060
ARHGAP25 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 25
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-685s1c1
Sequence:CCGGGCATGTATCTACCAGGATGTACTCGAGTACATCCTGGTAGATACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-1684s1c1
Sequence:CCGGGCAGCAAAGTACCCAGGGAAACTCGAGTTTCCCTGGGTACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-2093s1c1
Sequence:CCGGCCAAGAGCTACGAAAGGAAATCTCGAGATTTCCTTTCGTAGCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-1304s1c1
Sequence:CCGGCCTACATGAAATACAGCTGAACTCGAGTTCAGCTGTATTTCATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376060.1-738s1c1
Sequence:CCGGGCTGGGAAGTTTGTCTTTGAACTCGAGTTCAAAGACAAACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks