EMAIL THIS PAGE TO A FRIEND

ARHGAP26

Rho GTPase activating protein 26

129 Gene Product Result for
Synonyms: GRAF GRAF1 OPHN1L OPHN1L1
UniProtKB ID: Q9UNA1, O75117, Q5D035, Q9BYS6, Q9BYS7, Q9UJ00
Gene ID:
Human(23092) Summary: Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(71302) Rho GTPase activating protein 26
Rat(307459) Rho GTPase activating protein 26
chicken(396113) Rho GTPase activating protein 26
cow(538219) Rho GTPase activating protein 26
domestic cat(101082039) Rho GTPase activating protein 26
dog(478046) Rho GTPase activating protein 26
sheep(101109966) Rho GTPase activating protein 26
Domestic Rabbit(100216511) Rho GTPase activating protein 26
domestic guinea pig(100729488) Rho GTPase activating protein 26
naked mole-rat(101721150) Rho GTPase activating protein 26
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015071 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015071 Rosetta Predictions human pricing
NM_001107389 Rosetta Predictions rat pricing
NM_175164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346931 predicted 926
2 SASI_Hs01_00047970 predicted 1237
3 SASI_Hs01_00047971 predicted 657
4 SASI_Hs01_00047972 predicted 2271
5 SASI_Hs01_00047973 predicted 1694
6 SASI_Hs01_00047974 predicted 1750
7 SASI_Hs01_00047975 predicted 2350
8 SASI_Hs02_00346932 predicted 854
9 SASI_Hs01_00047976 predicted 1136
10 SASI_Hs01_00047978 predicted 1150
11 SASI_Hs01_00047977 predicted 738
12 SASI_Hs01_00047979 predicted 2177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228335 predicted 1144
2 SASI_Rn02_00228336 predicted 981
3 SASI_Rn02_00228337 predicted 1513
4 SASI_Rn02_00228338 predicted 892
5 SASI_Rn02_00228339 predicted 1947
6 SASI_Rn02_00228340 predicted 1317
7 SASI_Rn02_00228341 predicted 1615
8 SASI_Rn02_00228342 predicted 1647
9 SASI_Rn02_00228343 predicted 1424
10 SASI_Rn02_00228344 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163165 predicted 900
2 SASI_Mm01_00163166 predicted 1616
3 SASI_Mm02_00345801 predicted 1860
4 SASI_Mm01_00163167 predicted 578
5 SASI_Mm01_00163168 predicted 478
6 SASI_Mm01_00163169 predicted 841
7 SASI_Mm01_00163170 predicted 2255
8 SASI_Mm01_00163171 predicted 1962
9 SASI_Mm01_00163172 predicted 2567
10 SASI_Mm01_00163173 predicted 560
11 SASI_Mm01_00163174 predicted 1178
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175164
ARHGAP26 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 26
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175164.3-3676s1c1
Sequence:CCGGCCCAGAACAAAGAGAGGGAATCTCGAGATTCCCTCTCTTTGTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175164.3-780s1c1
Sequence:CCGGCGGCAACATTTCTACGAAGTACTCGAGTACTTCGTAGAAATGTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175164.3-1670s1c1
Sequence:CCGGCCAGTTTCAAAGAAGTTTCATCTCGAGATGAAACTTCTTTGAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175164.3-2687s1c1
Sequence:CCGGCCCAGAGAACTACGTGGAATTCTCGAGAATTCCACGTAGTTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175164.3-570s1c1
Sequence:CCGGCGGAGTCGAATGATCGAGAATCTCGAGATTCTCGATCATTCGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175164.4-581s21c1
Sequence:CCGGGCGAGATCTTTGCAAGAATTTCTCGAGAAATTCTTGCAAAGATCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175164.4-3124s21c1
Sequence:CCGGAGGATGAGAATAGTGCTAAAGCTCGAGCTTTAGCACTATTCTCATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175164
ARHGAP26 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 26
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175164.3-3676s1c1
Sequence:CCGGCCCAGAACAAAGAGAGGGAATCTCGAGATTCCCTCTCTTTGTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175164.3-780s1c1
Sequence:CCGGCGGCAACATTTCTACGAAGTACTCGAGTACTTCGTAGAAATGTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175164.3-1670s1c1
Sequence:CCGGCCAGTTTCAAAGAAGTTTCATCTCGAGATGAAACTTCTTTGAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175164.3-2687s1c1
Sequence:CCGGCCCAGAGAACTACGTGGAATTCTCGAGAATTCCACGTAGTTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175164.3-570s1c1
Sequence:CCGGCGGAGTCGAATGATCGAGAATCTCGAGATTCTCGATCATTCGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175164.4-581s21c1
Sequence:CCGGGCGAGATCTTTGCAAGAATTTCTCGAGAAATTCTTGCAAAGATCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175164.4-3124s21c1
Sequence:CCGGAGGATGAGAATAGTGCTAAAGCTCGAGCTTTAGCACTATTCTCATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175164
ARHGAP26 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 26
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175164.3-3676s1c1
Sequence:CCGGCCCAGAACAAAGAGAGGGAATCTCGAGATTCCCTCTCTTTGTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175164.3-780s1c1
Sequence:CCGGCGGCAACATTTCTACGAAGTACTCGAGTACTTCGTAGAAATGTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175164.3-1670s1c1
Sequence:CCGGCCAGTTTCAAAGAAGTTTCATCTCGAGATGAAACTTCTTTGAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175164.3-2687s1c1
Sequence:CCGGCCCAGAGAACTACGTGGAATTCTCGAGAATTCCACGTAGTTCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175164.3-570s1c1
Sequence:CCGGCGGAGTCGAATGATCGAGAATCTCGAGATTCTCGATCATTCGACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175164.4-581s21c1
Sequence:CCGGGCGAGATCTTTGCAAGAATTTCTCGAGAAATTCTTGCAAAGATCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175164.4-3124s21c1
Sequence:CCGGAGGATGAGAATAGTGCTAAAGCTCGAGCTTTAGCACTATTCTCATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015071
ARHGAP26 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 26
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-1140s1c1
Sequence:CCGGCCTGTCTACAACTCGAACAAACTCGAGTTTGTTCGAGTTGTAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-2340s1c1
Sequence:CCGGGCTGAACATGACTCAGAACTTCTCGAGAAGTTCTGAGTCATGTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-1201s1c1
Sequence:CCGGGCTTCAGCATAATCAGGAAATCTCGAGATTTCCTGATTATGCTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-546s1c1
Sequence:CCGGCGGCAGCATTTCTATGAAGTACTCGAGTACTTCATAGAAATGCTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-2453s1c1
Sequence:CCGGCCCTGAGAATTACGTGGAGTTCTCGAGAACTCCACGTAATTCTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015071.4-1423s21c1
Sequence:CCGGCACTCATGATGTACCAGTTTCCTCGAGGAAACTGGTACATCATGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015071.4-331s21c1
Sequence:CCGGATGAACGGATACGGATGATTGCTCGAGCAATCATCCGTATCCGTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015071
ARHGAP26 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 26
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-1140s1c1
Sequence:CCGGCCTGTCTACAACTCGAACAAACTCGAGTTTGTTCGAGTTGTAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-2340s1c1
Sequence:CCGGGCTGAACATGACTCAGAACTTCTCGAGAAGTTCTGAGTCATGTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-1201s1c1
Sequence:CCGGGCTTCAGCATAATCAGGAAATCTCGAGATTTCCTGATTATGCTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-546s1c1
Sequence:CCGGCGGCAGCATTTCTATGAAGTACTCGAGTACTTCATAGAAATGCTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-2453s1c1
Sequence:CCGGCCCTGAGAATTACGTGGAGTTCTCGAGAACTCCACGTAATTCTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015071.4-1423s21c1
Sequence:CCGGCACTCATGATGTACCAGTTTCCTCGAGGAAACTGGTACATCATGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015071.4-331s21c1
Sequence:CCGGATGAACGGATACGGATGATTGCTCGAGCAATCATCCGTATCCGTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015071
ARHGAP26 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 26
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-1140s1c1
Sequence:CCGGCCTGTCTACAACTCGAACAAACTCGAGTTTGTTCGAGTTGTAGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-2340s1c1
Sequence:CCGGGCTGAACATGACTCAGAACTTCTCGAGAAGTTCTGAGTCATGTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-1201s1c1
Sequence:CCGGGCTTCAGCATAATCAGGAAATCTCGAGATTTCCTGATTATGCTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-546s1c1
Sequence:CCGGCGGCAGCATTTCTATGAAGTACTCGAGTACTTCATAGAAATGCTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015071.2-2453s1c1
Sequence:CCGGCCCTGAGAATTACGTGGAGTTCTCGAGAACTCCACGTAATTCTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015071.4-1423s21c1
Sequence:CCGGCACTCATGATGTACCAGTTTCCTCGAGGAAACTGGTACATCATGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015071.4-331s21c1
Sequence:CCGGATGAACGGATACGGATGATTGCTCGAGCAATCATCCGTATCCGTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)