EMAIL THIS PAGE TO A FRIEND

ARHGAP27

Rho GTPase activating protein 27

Synonyms: CAMGAP1 PP905 SH3D20 SH3P20
Gene ID:
Human(201176) Summary: Rho (see ARHA; MIM 165390)-like small GTPases are involved in many cellular processes, and they are inactive in the GDP-bound state and active in the GTP-bound state. GTPase-activating proteins, such as ARHGAP27, inhibit Rho-like proteins by stimulating their intrinsic GTPase activity (Katoh and Katoh, 2004 [PubMed 15492870]
Mouse(544817) Rho GTPase activating protein 27
Rat(303583) Rho GTPase activating protein 27
Zebrafish(564211) Rho GTPase activating protein 27
cow(789296) Rho GTPase activating protein 27
Horse(100050074) Rho GTPase activating protein 27
domestic cat(101087538) Rho GTPase activating protein 27
dog(100688313) Rho GTPase activating protein 27
chicken(770740) Rho GTPase activating protein 27
naked mole-rat(101716436) Rho GTPase activating protein 27
domestic guinea pig(100719304) Rho GTPase activating protein 27
sheep(101119739) Rho GTPase activating protein 27
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199282 Rosetta Predictions human pricing
NM_198759 Rosetta Predictions rat pricing
NM_133715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112624 predicted 942
2 SASI_Hs01_00112625 predicted 2234
3 SASI_Hs01_00112626 predicted 1778
4 SASI_Hs01_00112627 predicted 1621
5 SASI_Hs01_00112628 predicted 1644
6 SASI_Hs01_00112629 predicted 1868
7 SASI_Hs01_00112630 predicted 1210
8 SASI_Hs01_00112631 predicted 1941
9 SASI_Hs01_00112632 predicted 2058
10 SASI_Hs01_00112633 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109625 predicted 2172
2 SASI_Rn01_00109626 predicted 1242
3 SASI_Rn01_00109627 predicted 1208
4 SASI_Rn01_00109628 predicted 583
5 SASI_Rn02_00269998 predicted 2229
6 SASI_Rn01_00109629 predicted 1700
7 SASI_Rn02_00269999 predicted 1286
8 SASI_Rn01_00109630 predicted 1090
9 SASI_Rn01_00109631 predicted 1107
10 SASI_Rn01_00109632 predicted 1085
11 SASI_Rn01_00109624 predicted 1292
12 SASI_Rn01_00109633 predicted 2019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109780 predicted 822
2 SASI_Mm01_00109782 predicted 1713
3 SASI_Mm01_00109783 predicted 1218
4 SASI_Mm01_00109784 predicted 776
5 SASI_Mm01_00109785 predicted 1202
6 SASI_Mm01_00109786 predicted 747
7 SASI_Mm02_00338687 predicted 2119
8 SASI_Mm01_00109787 predicted 1482
9 SASI_Mm01_00109788 predicted 1409
10 SASI_Mm01_00109789 predicted 2105
11 SASI_Mm01_00109781 predicted 2125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199282
ARHGAP27 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 27
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199282.2-1012s21c1
Sequence:CCGGGTGGCGTCCTGACATTCTTCACTCGAGTGAAGAATGTCAGGACGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199282.2-770s21c1
Sequence:CCGGCCCTCGAAGCATCCATAAATCCTCGAGGATTTATGGATGCTTCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199282.2-2254s21c1
Sequence:CCGGCCCTAGTGGGCAGTTTGCAAACTCGAGTTTGCAAACTGCCCACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199282.2-549s21c1
Sequence:CCGGTATTCTCCCGTGGGCTCTTTCCTCGAGGAAAGAGCCCACGGGAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-683s1c1
Sequence:CCGGCGGGAAGCCATACTTCTACAACTCGAGTTGTAGAAGTATGGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-1630s1c1
Sequence:CCGGCCATCCAGAAGCTACGCTATACTCGAGTATAGCGTAGCTTCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-1778s1c1
Sequence:CCGGCCAGTTCATTGCGGCCATCAACTCGAGTTGATGGCCGCAATGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-1124s1c1
Sequence:CCGGAGACAAATCCAGTAGGAAGAACTCGAGTTCTTCCTACTGGATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-620s1c1
Sequence:CCGGCAAGCAGATGCTCTACACCAACTCGAGTTGGTGTAGAGCATCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199282
ARHGAP27 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 27
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199282.2-1012s21c1
Sequence:CCGGGTGGCGTCCTGACATTCTTCACTCGAGTGAAGAATGTCAGGACGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199282.2-770s21c1
Sequence:CCGGCCCTCGAAGCATCCATAAATCCTCGAGGATTTATGGATGCTTCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199282.2-2254s21c1
Sequence:CCGGCCCTAGTGGGCAGTTTGCAAACTCGAGTTTGCAAACTGCCCACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199282.2-549s21c1
Sequence:CCGGTATTCTCCCGTGGGCTCTTTCCTCGAGGAAAGAGCCCACGGGAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-683s1c1
Sequence:CCGGCGGGAAGCCATACTTCTACAACTCGAGTTGTAGAAGTATGGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-1630s1c1
Sequence:CCGGCCATCCAGAAGCTACGCTATACTCGAGTATAGCGTAGCTTCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-1778s1c1
Sequence:CCGGCCAGTTCATTGCGGCCATCAACTCGAGTTGATGGCCGCAATGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-1124s1c1
Sequence:CCGGAGACAAATCCAGTAGGAAGAACTCGAGTTCTTCCTACTGGATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-620s1c1
Sequence:CCGGCAAGCAGATGCTCTACACCAACTCGAGTTGGTGTAGAGCATCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199282
ARHGAP27 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 27
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199282.2-1012s21c1
Sequence:CCGGGTGGCGTCCTGACATTCTTCACTCGAGTGAAGAATGTCAGGACGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199282.2-770s21c1
Sequence:CCGGCCCTCGAAGCATCCATAAATCCTCGAGGATTTATGGATGCTTCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199282.2-2254s21c1
Sequence:CCGGCCCTAGTGGGCAGTTTGCAAACTCGAGTTTGCAAACTGCCCACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199282.2-549s21c1
Sequence:CCGGTATTCTCCCGTGGGCTCTTTCCTCGAGGAAAGAGCCCACGGGAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-683s1c1
Sequence:CCGGCGGGAAGCCATACTTCTACAACTCGAGTTGTAGAAGTATGGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-1630s1c1
Sequence:CCGGCCATCCAGAAGCTACGCTATACTCGAGTATAGCGTAGCTTCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-1778s1c1
Sequence:CCGGCCAGTTCATTGCGGCCATCAACTCGAGTTGATGGCCGCAATGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-1124s1c1
Sequence:CCGGAGACAAATCCAGTAGGAAGAACTCGAGTTCTTCCTACTGGATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199282.1-620s1c1
Sequence:CCGGCAAGCAGATGCTCTACACCAACTCGAGTTGGTGTAGAGCATCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133715
VALIDATED
ARHGAP27 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 27
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133715.4-815s21c1
Sequence:CCGGCAGCACGGGAAGCCATATTTCCTCGAGGAAATATGGCTTCCCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133715.4-1480s21c1
Sequence:CCGGCCGGCACAAGCTCCGTAAATTCTCGAGAATTTACGGAGCTTGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133715.4-3274s21c1
Sequence:CCGGGGTTTCATGCAGTCCATATTTCTCGAGAAATATGGACTGCATGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133715.4-729s21c1
Sequence:CCGGCTGGCTGGTCCTGTCAAATTACTCGAGTAATTTGACAGGACCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133715
VALIDATED
ARHGAP27 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 27
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133715.4-815s21c1
Sequence:CCGGCAGCACGGGAAGCCATATTTCCTCGAGGAAATATGGCTTCCCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133715.4-1480s21c1
Sequence:CCGGCCGGCACAAGCTCCGTAAATTCTCGAGAATTTACGGAGCTTGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133715.4-3274s21c1
Sequence:CCGGGGTTTCATGCAGTCCATATTTCTCGAGAAATATGGACTGCATGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133715.4-729s21c1
Sequence:CCGGCTGGCTGGTCCTGTCAAATTACTCGAGTAATTTGACAGGACCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133715
VALIDATED
ARHGAP27 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 27
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133715.4-815s21c1
Sequence:CCGGCAGCACGGGAAGCCATATTTCCTCGAGGAAATATGGCTTCCCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133715.4-1480s21c1
Sequence:CCGGCCGGCACAAGCTCCGTAAATTCTCGAGAATTTACGGAGCTTGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133715.4-3274s21c1
Sequence:CCGGGGTTTCATGCAGTCCATATTTCTCGAGAAATATGGACTGCATGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133715.4-729s21c1
Sequence:CCGGCTGGCTGGTCCTGTCAAATTACTCGAGTAATTTGACAGGACCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks