EMAIL THIS PAGE TO A FRIEND

ARHGAP28

Rho GTPase activating protein 28

161 Gene Product Result for
UniProtKB ID: Q9P2N2, A8MQB7, A8MU88, Q6P160, Q8N4T3, Q9NW53
Gene ID:
Mouse(268970) Rho GTPase activating protein 28
Rat(301709) Rho GTPase activating protein 28
sheep(101102444) Rho GTPase activating protein 28
Domestic Rabbit(100340067) Rho GTPase activating protein 28
domestic guinea pig(100715109) Rho GTPase activating protein 28
naked mole-rat(101705924) Rho GTPase activating protein 28
Zebrafish(492794) Rho GTPase activating protein 28
dog(490543) Rho GTPase activating protein 28
Horse(100059766) Rho GTPase activating protein 28
cow(530550) Rho GTPase activating protein 28
domestic cat(101081503) Rho GTPase activating protein 28
chicken(421053) Rho GTPase activating protein 28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030672 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010000 Rosetta Predictions human pricing
NM_030672 Rosetta Predictions human pricing
XM_001054365 Rosetta Predictions rat pricing
XM_237535 Rosetta Predictions rat pricing
NM_172964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163016 predicted 216
2 SASI_Hs01_00163017 predicted 992
3 SASI_Hs01_00163018 predicted 577
4 SASI_Hs01_00163019 predicted 1092
5 SASI_Hs01_00163020 predicted 1458
6 SASI_Hs01_00163021 predicted 363
7 SASI_Hs01_00163022 predicted 767
8 SASI_Hs01_00163023 predicted 1046
9 SASI_Hs01_00163024 predicted 1213
10 SASI_Hs01_00163025 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175910 predicted 216
2 SASI_Hs01_00175911 predicted 992
3 SASI_Hs01_00175912 predicted 585
4 SASI_Hs01_00175913 predicted 1086
5 SASI_Hs01_00175914 predicted 1456
6 SASI_Hs01_00175915 predicted 359
7 SASI_Hs01_00175916 predicted 768
8 SASI_Hs01_00175917 predicted 1053
9 SASI_Hs01_00175918 predicted 1212
10 SASI_Hs01_00175919 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275598 predicted 1140
2 SASI_Rn02_00275599 predicted 614
3 SASI_Rn02_00275600 predicted 1393
4 SASI_Rn02_00275601 predicted 819
5 SASI_Rn02_00275602 predicted 806
6 SASI_Rn02_00275603 predicted 1349
7 SASI_Rn02_00275604 predicted 1564
8 SASI_Rn02_00275605 predicted 1010
9 SASI_Rn02_00275606 predicted 844
10 SASI_Rn02_00275607 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390989 predicted 993
2 SASI_Rn02_00390990 predicted 1136
3 SASI_Rn02_00390991 predicted 613
4 SASI_Rn02_00390992 predicted 1396
5 SASI_Rn02_00390993 predicted 821
6 SASI_Rn02_00390994 predicted 802
7 SASI_Rn02_00390995 predicted 1346
8 SASI_Rn02_00390996 predicted 1019
9 SASI_Rn02_00390997 predicted 843
10 SASI_Rn02_00390998 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108140 predicted 1328
2 SASI_Mm01_00108141 predicted 2087
3 SASI_Mm01_00108142 predicted 1665
4 SASI_Mm01_00108143 predicted 591
5 SASI_Mm01_00108144 predicted 2063
6 SASI_Mm01_00108145 predicted 1378
7 SASI_Mm02_00345013 predicted 1958
8 SASI_Mm01_00108146 predicted 1679
9 SASI_Mm01_00108148 predicted 854
10 SASI_Mm01_00108149 predicted 990
11 SASI_Mm01_00108147 predicted 905
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030672
ARHGAP28 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 28
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-1702s1c1
Sequence:CCGGCAACTCAACAATCAAACCAAACTCGAGTTTGGTTTGATTGTTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030672.2-520s1c1
Sequence:CCGGCCAGTTCAGAATGCGATAAGTCTCGAGACTTATCGCATTCTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-1188s1c1
Sequence:CCGGGCCTCACGTCAAAGTACAGTTCTCGAGAACTGTACTTTGACGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030672.2-1869s1c1
Sequence:CCGGCTTCACTATTGGCCTGGACATCTCGAGATGTCCAGGCCAATAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-517s1c1
Sequence:CCGGCAGCCAGTTCAGAATGCGATACTCGAGTATCGCATTCTGAACTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-610s1c1
Sequence:CCGGGAAATGGTTACGGAGGCTCTACTCGAGTAGAGCCTCCGTAACCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-1696s1c1
Sequence:CCGGGCCATTCAACTCAACAATCAACTCGAGTTGATTGTTGAGTTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030672
ARHGAP28 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 28
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-1702s1c1
Sequence:CCGGCAACTCAACAATCAAACCAAACTCGAGTTTGGTTTGATTGTTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030672.2-520s1c1
Sequence:CCGGCCAGTTCAGAATGCGATAAGTCTCGAGACTTATCGCATTCTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-1188s1c1
Sequence:CCGGGCCTCACGTCAAAGTACAGTTCTCGAGAACTGTACTTTGACGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030672.2-1869s1c1
Sequence:CCGGCTTCACTATTGGCCTGGACATCTCGAGATGTCCAGGCCAATAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-517s1c1
Sequence:CCGGCAGCCAGTTCAGAATGCGATACTCGAGTATCGCATTCTGAACTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-610s1c1
Sequence:CCGGGAAATGGTTACGGAGGCTCTACTCGAGTAGAGCCTCCGTAACCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-1696s1c1
Sequence:CCGGGCCATTCAACTCAACAATCAACTCGAGTTGATTGTTGAGTTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030672
ARHGAP28 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 28
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-1702s1c1
Sequence:CCGGCAACTCAACAATCAAACCAAACTCGAGTTTGGTTTGATTGTTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030672.2-520s1c1
Sequence:CCGGCCAGTTCAGAATGCGATAAGTCTCGAGACTTATCGCATTCTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-1188s1c1
Sequence:CCGGGCCTCACGTCAAAGTACAGTTCTCGAGAACTGTACTTTGACGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030672.2-1869s1c1
Sequence:CCGGCTTCACTATTGGCCTGGACATCTCGAGATGTCCAGGCCAATAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-517s1c1
Sequence:CCGGCAGCCAGTTCAGAATGCGATACTCGAGTATCGCATTCTGAACTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-610s1c1
Sequence:CCGGGAAATGGTTACGGAGGCTCTACTCGAGTAGAGCCTCCGTAACCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030672.2-1696s1c1
Sequence:CCGGGCCATTCAACTCAACAATCAACTCGAGTTGATTGTTGAGTTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172964
ARHGAP28 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 28
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172964.1-1824s1c1
Sequence:CCGGCCTGATGCTGAAGTACCAGAACTCGAGTTCTGGTACTTCAGCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172964.1-1854s1c1
Sequence:CCGGGAAGGTTCCATCTTTCTTGATCTCGAGATCAAGAAAGATGGAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172964.1-354s1c1
Sequence:CCGGGCGGGAAATTGAGAGTATCAACTCGAGTTGATACTCTCAATTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172964.1-670s1c1
Sequence:CCGGCCTAGTGATTCTTGTGAGCATCTCGAGATGCTCACAAGAATCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-844s21c1
Sequence:CCGGTTGAGGCTATCCCGGATATTGCTCGAGCAATATCCGGGATAGCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172964.4-2735s21c1
Sequence:CCGGAGTACTCAGATGCTACGTTATCTCGAGATAACGTAGCATCTGAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-1022s21c1
Sequence:CCGGATGGAAGAAGTCGGACATTAACTCGAGTTAATGTCCGACTTCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172964.4-2314s21c1
Sequence:CCGGATGGTTCCTGCCCTGTATTATCTCGAGATAATACAGGGCAGGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-2281s21c1
Sequence:CCGGAGCCCTAGACAAGTCTTTAAACTCGAGTTTAAAGACTTGTCTAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-2217s21c1
Sequence:CCGGTTAGATCCTGATGCATATATACTCGAGTATATATGCATCAGGATCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-2143s21c1
Sequence:CCGGATGGTTCATCTGAACATATTACTCGAGTAATATGTTCAGATGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172964
ARHGAP28 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 28
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172964.1-1824s1c1
Sequence:CCGGCCTGATGCTGAAGTACCAGAACTCGAGTTCTGGTACTTCAGCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172964.1-1854s1c1
Sequence:CCGGGAAGGTTCCATCTTTCTTGATCTCGAGATCAAGAAAGATGGAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172964.1-354s1c1
Sequence:CCGGGCGGGAAATTGAGAGTATCAACTCGAGTTGATACTCTCAATTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172964.1-670s1c1
Sequence:CCGGCCTAGTGATTCTTGTGAGCATCTCGAGATGCTCACAAGAATCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-844s21c1
Sequence:CCGGTTGAGGCTATCCCGGATATTGCTCGAGCAATATCCGGGATAGCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172964.4-2735s21c1
Sequence:CCGGAGTACTCAGATGCTACGTTATCTCGAGATAACGTAGCATCTGAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-1022s21c1
Sequence:CCGGATGGAAGAAGTCGGACATTAACTCGAGTTAATGTCCGACTTCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172964.4-2314s21c1
Sequence:CCGGATGGTTCCTGCCCTGTATTATCTCGAGATAATACAGGGCAGGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-2281s21c1
Sequence:CCGGAGCCCTAGACAAGTCTTTAAACTCGAGTTTAAAGACTTGTCTAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-2217s21c1
Sequence:CCGGTTAGATCCTGATGCATATATACTCGAGTATATATGCATCAGGATCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-2143s21c1
Sequence:CCGGATGGTTCATCTGAACATATTACTCGAGTAATATGTTCAGATGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172964
ARHGAP28 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 28
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172964.1-1824s1c1
Sequence:CCGGCCTGATGCTGAAGTACCAGAACTCGAGTTCTGGTACTTCAGCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172964.1-1854s1c1
Sequence:CCGGGAAGGTTCCATCTTTCTTGATCTCGAGATCAAGAAAGATGGAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172964.1-354s1c1
Sequence:CCGGGCGGGAAATTGAGAGTATCAACTCGAGTTGATACTCTCAATTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172964.1-670s1c1
Sequence:CCGGCCTAGTGATTCTTGTGAGCATCTCGAGATGCTCACAAGAATCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-844s21c1
Sequence:CCGGTTGAGGCTATCCCGGATATTGCTCGAGCAATATCCGGGATAGCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172964.4-2735s21c1
Sequence:CCGGAGTACTCAGATGCTACGTTATCTCGAGATAACGTAGCATCTGAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-1022s21c1
Sequence:CCGGATGGAAGAAGTCGGACATTAACTCGAGTTAATGTCCGACTTCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172964.4-2314s21c1
Sequence:CCGGATGGTTCCTGCCCTGTATTATCTCGAGATAATACAGGGCAGGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-2281s21c1
Sequence:CCGGAGCCCTAGACAAGTCTTTAAACTCGAGTTTAAAGACTTGTCTAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-2217s21c1
Sequence:CCGGTTAGATCCTGATGCATATATACTCGAGTATATATGCATCAGGATCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172964.4-2143s21c1
Sequence:CCGGATGGTTCATCTGAACATATTACTCGAGTAATATGTTCAGATGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks