EMAIL THIS PAGE TO A FRIEND

ARHGAP29

Rho GTPase activating protein 29

53 Gene Product Result for
Synonyms: PARG1 RP11-255E17.1
UniProtKB ID: Q52LW3, O15463, Q59H86, Q5VYZ0, Q6NVX2, Q8TBI6
Gene ID:
Mouse(214137) Rho GTPase activating protein 29
Rat(310833) Rho GTPase activating protein 29
chicken(424488) Rho GTPase activating protein 29
domestic cat(101099818) Rho GTPase activating protein 29
dog(479940) Rho GTPase activating protein 29
cow(504657) Rho GTPase activating protein 29
naked mole-rat(101702972) Rho GTPase activating protein 29
domestic guinea pig(100718548) Rho GTPase activating protein 29
sheep(101107830) Rho GTPase activating protein 29
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004815 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172525 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172525 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172525 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004815 Rosetta Predictions human pricing
NM_001009405 Rosetta Predictions rat pricing
NM_172525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178119 predicted 3029
2 SASI_Hs01_00178120 predicted 1859
3 SASI_Hs02_00338362 predicted 652
4 SASI_Hs01_00178121 predicted 2243
5 SASI_Hs02_00338363 predicted 466
6 SASI_Hs02_00338364 predicted 1917
7 SASI_Hs02_00338365 predicted 1935
8 SASI_Hs01_00178122 predicted 2789
9 SASI_Hs01_00178125 predicted 2226
10 SASI_Hs01_00178126 predicted 3060
11 SASI_Hs01_00178117 predicted 3908
12 SASI_Hs01_00178118 predicted 2663
13 SASI_Hs01_00178123 predicted 1483
14 SASI_Hs01_00178124 predicted 3458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039982 predicted 514
2 SASI_Rn01_00039983 predicted 2993
3 SASI_Rn01_00039984 predicted 1990
4 SASI_Rn01_00039985 predicted 892
5 SASI_Rn01_00039986 predicted 863
6 SASI_Rn01_00039987 predicted 1776
7 SASI_Rn01_00039988 predicted 3028
8 SASI_Rn01_00039989 predicted 2702
9 SASI_Rn01_00039990 predicted 2390
10 SASI_Rn01_00039991 predicted 3421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030241 predicted 2483
2 SASI_Mm02_00344123 predicted 1760
3 SASI_Mm01_00030243 predicted 803
4 SASI_Mm01_00030244 predicted 297
5 SASI_Mm01_00030245 predicted 589
6 SASI_Mm01_00030246 predicted 850
7 SASI_Mm02_00344124 predicted 547
8 SASI_Mm01_00030247 predicted 889
9 SASI_Mm01_00030248 predicted 581
10 SASI_Mm01_00030249 predicted 2922
11 SASI_Mm01_00030242 predicted 3799
12 SASI_Mm01_00030250 predicted 3655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004815
ARHGAP29 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 29
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004815.3-467s21c1
Sequence:CCGGCCTTAAGTTCCAACTCTATTTCTCGAGAAATAGAGTTGGAACTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004815.3-4394s21c1
Sequence:CCGGTAAGATAGGTGGATTCGTATTCTCGAGAATACGAATCCACCTATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004815.3-2640s21c1
Sequence:CCGGTCGATTGTACAAGGAATTTATCTCGAGATAAATTCCTTGTACAATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004815.x-801s1c1
Sequence:CCGGGCTGGCTTTGTCATATGCTAACTCGAGTTAGCATATGACAAAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004815.x-4162s1c1
Sequence:CCGGGCCTCACTGGAATTATCTTTACTCGAGTAAAGATAATTCCAGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004815.x-1440s1c1
Sequence:CCGGCCAGTGTGATCTTACCCTTAACTCGAGTTAAGGGTAAGATCACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004815.x-2662s1c1
Sequence:CCGGCGGGTAGTAGATCATGCAGAACTCGAGTTCTGCATGATCTACTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004815.x-2008s1c1
Sequence:CCGGGCAGCTCTCACACACAAGTTTCTCGAGAAACTTGTGTGTGAGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004815
ARHGAP29 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 29
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004815.3-467s21c1
Sequence:CCGGCCTTAAGTTCCAACTCTATTTCTCGAGAAATAGAGTTGGAACTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004815.3-4394s21c1
Sequence:CCGGTAAGATAGGTGGATTCGTATTCTCGAGAATACGAATCCACCTATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004815.3-2640s21c1
Sequence:CCGGTCGATTGTACAAGGAATTTATCTCGAGATAAATTCCTTGTACAATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004815.x-801s1c1
Sequence:CCGGGCTGGCTTTGTCATATGCTAACTCGAGTTAGCATATGACAAAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004815.x-4162s1c1
Sequence:CCGGGCCTCACTGGAATTATCTTTACTCGAGTAAAGATAATTCCAGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004815.x-1440s1c1
Sequence:CCGGCCAGTGTGATCTTACCCTTAACTCGAGTTAAGGGTAAGATCACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004815.x-2662s1c1
Sequence:CCGGCGGGTAGTAGATCATGCAGAACTCGAGTTCTGCATGATCTACTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004815.x-2008s1c1
Sequence:CCGGGCAGCTCTCACACACAAGTTTCTCGAGAAACTTGTGTGTGAGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004815
ARHGAP29 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 29
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004815.3-467s21c1
Sequence:CCGGCCTTAAGTTCCAACTCTATTTCTCGAGAAATAGAGTTGGAACTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004815.3-4394s21c1
Sequence:CCGGTAAGATAGGTGGATTCGTATTCTCGAGAATACGAATCCACCTATCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004815.3-2640s21c1
Sequence:CCGGTCGATTGTACAAGGAATTTATCTCGAGATAAATTCCTTGTACAATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004815.x-801s1c1
Sequence:CCGGGCTGGCTTTGTCATATGCTAACTCGAGTTAGCATATGACAAAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004815.x-4162s1c1
Sequence:CCGGGCCTCACTGGAATTATCTTTACTCGAGTAAAGATAATTCCAGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004815.x-1440s1c1
Sequence:CCGGCCAGTGTGATCTTACCCTTAACTCGAGTTAAGGGTAAGATCACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004815.x-2662s1c1
Sequence:CCGGCGGGTAGTAGATCATGCAGAACTCGAGTTCTGCATGATCTACTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004815.x-2008s1c1
Sequence:CCGGGCAGCTCTCACACACAAGTTTCTCGAGAAACTTGTGTGTGAGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172525
VALIDATED
ARHGAP29 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 29
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172525.2-2291s21c1
Sequence:CCGGGGATGCACTTAGTAGACATTTCTCGAGAAATGTCTACTAAGTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172525.2-588s21c1
Sequence:CCGGGATACTACGTCTACCTATTTCCTCGAGGAAATAGGTAGACGTAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172525.2-1901s21c1
Sequence:CCGGCCAATTCCCTCGGAGCATTTACTCGAGTAAATGCTCCGAGGGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172525.2-3840s21c1
Sequence:CCGGTTGCCAGAGACCACGACTAAACTCGAGTTTAGTCGTGGTCTCTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172525.1-539s1c1
Sequence:CCGGCCATTGAAACATTGGCATTTACTCGAGTAAATGCCAATGTTTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172525.1-475s1c1
Sequence:CCGGGCTGTGAACTTTACAGAAGTTCTCGAGAACTTCTGTAAAGTTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172525.1-2755s1c1
Sequence:CCGGGCACGATTAGTAGAGTTCCTTCTCGAGAAGGAACTCTACTAATCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172525.1-1819s1c1
Sequence:CCGGCCAGGAGACTTTCATCGGAAACTCGAGTTTCCGATGAAAGTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172525.1-3057s1c1
Sequence:CCGGCCTCGACAACAAAGTACATTTCTCGAGAAATGTACTTTGTTGTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172525
VALIDATED
ARHGAP29 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 29
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172525.2-2291s21c1
Sequence:CCGGGGATGCACTTAGTAGACATTTCTCGAGAAATGTCTACTAAGTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172525.2-588s21c1
Sequence:CCGGGATACTACGTCTACCTATTTCCTCGAGGAAATAGGTAGACGTAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172525.2-1901s21c1
Sequence:CCGGCCAATTCCCTCGGAGCATTTACTCGAGTAAATGCTCCGAGGGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172525.2-3840s21c1
Sequence:CCGGTTGCCAGAGACCACGACTAAACTCGAGTTTAGTCGTGGTCTCTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172525.1-539s1c1
Sequence:CCGGCCATTGAAACATTGGCATTTACTCGAGTAAATGCCAATGTTTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172525.1-475s1c1
Sequence:CCGGGCTGTGAACTTTACAGAAGTTCTCGAGAACTTCTGTAAAGTTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172525.1-2755s1c1
Sequence:CCGGGCACGATTAGTAGAGTTCCTTCTCGAGAAGGAACTCTACTAATCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172525.1-1819s1c1
Sequence:CCGGCCAGGAGACTTTCATCGGAAACTCGAGTTTCCGATGAAAGTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172525.1-3057s1c1
Sequence:CCGGCCTCGACAACAAAGTACATTTCTCGAGAAATGTACTTTGTTGTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172525
VALIDATED
ARHGAP29 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 29
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172525.2-2291s21c1
Sequence:CCGGGGATGCACTTAGTAGACATTTCTCGAGAAATGTCTACTAAGTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172525.2-588s21c1
Sequence:CCGGGATACTACGTCTACCTATTTCCTCGAGGAAATAGGTAGACGTAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172525.2-1901s21c1
Sequence:CCGGCCAATTCCCTCGGAGCATTTACTCGAGTAAATGCTCCGAGGGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172525.2-3840s21c1
Sequence:CCGGTTGCCAGAGACCACGACTAAACTCGAGTTTAGTCGTGGTCTCTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172525.1-539s1c1
Sequence:CCGGCCATTGAAACATTGGCATTTACTCGAGTAAATGCCAATGTTTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172525.1-475s1c1
Sequence:CCGGGCTGTGAACTTTACAGAAGTTCTCGAGAACTTCTGTAAAGTTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172525.1-2755s1c1
Sequence:CCGGGCACGATTAGTAGAGTTCCTTCTCGAGAAGGAACTCTACTAATCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172525.1-1819s1c1
Sequence:CCGGCCAGGAGACTTTCATCGGAAACTCGAGTTTCCGATGAAAGTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172525.1-3057s1c1
Sequence:CCGGCCTCGACAACAAAGTACATTTCTCGAGAAATGTACTTTGTTGTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks