EMAIL THIS PAGE TO A FRIEND

ARHGAP30

Rho GTPase activating protein 30

137 Gene Product Result for
Gene ID:
Mouse(226652) Rho GTPase activating protein 30
Rat(498282) Rho GTPase activating protein 30
Horse(100066336) Rho GTPase activating protein 30
cow(538835) Rho GTPase activating protein 30
domestic cat(101092732) Rho GTPase activating protein 30
dog(488647) Rho GTPase activating protein 30
sheep(101123168) Rho GTPase activating protein 30
Domestic Rabbit(100340410) Rho GTPase activating protein 30
domestic guinea pig(100734051) Rho GTPase activating protein 30
naked mole-rat(101710992) Rho GTPase activating protein 30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0569 AQUA Peptide AQVEAG[R] human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181720 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025598 Rosetta Predictions human pricing
NM_181720 Rosetta Predictions human pricing
NM_001109077 Rosetta Predictions rat pricing
NM_001005508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060084 predicted 1092
2 SASI_Hs01_00060085 predicted 528
3 SASI_Hs01_00060086 predicted 550
4 SASI_Hs01_00060087 predicted 3740
5 SASI_Hs01_00060090 predicted 921
6 SASI_Hs01_00060091 predicted 3580
7 SASI_Hs02_00307474 predicted 451
8 SASI_Hs01_00060092 predicted 887
9 SASI_Hs02_00307475 predicted 676
10 SASI_Hs01_00060093 predicted 802
11 SASI_Hs01_00060088 predicted 588
12 SASI_Hs01_00060089 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034339 predicted 1089
2 SASI_Hs01_00034340 predicted 535
3 SASI_Hs01_00034341 predicted 547
4 SASI_Hs01_00034342 predicted 3109
5 SASI_Hs01_00034345 predicted 920
6 SASI_Hs01_00034346 predicted 2941
7 SASI_Hs02_00370329 predicted 451
8 SASI_Hs01_00034347 predicted 883
9 SASI_Hs02_00370330 predicted 674
10 SASI_Hs01_00034348 predicted 797
11 SASI_Hs01_00034343 predicted 591
12 SASI_Hs01_00034344 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244900 predicted 895
2 SASI_Rn02_00244901 predicted 980
3 SASI_Rn02_00244902 predicted 2929
4 SASI_Rn02_00244903 predicted 935
5 SASI_Rn02_00244904 predicted 1364
6 SASI_Rn02_00244905 predicted 3332
7 SASI_Rn02_00244906 predicted 3197
8 SASI_Rn02_00244907 predicted 3437
9 SASI_Rn02_00244908 predicted 2817
10 SASI_Rn02_00244909 predicted 3378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151089 predicted 1331
2 SASI_Mm01_00151090 predicted 3075
3 SASI_Mm01_00151091 predicted 1113
4 SASI_Mm01_00151092 predicted 2834
5 SASI_Mm01_00151093 predicted 506
6 SASI_Mm01_00151094 predicted 2867
7 SASI_Mm01_00151096 predicted 2942
8 SASI_Mm01_00151097 predicted 1637
9 SASI_Mm02_00286608 predicted 2954
10 SASI_Mm01_00151098 predicted 1969
11 SASI_Mm01_00151095 predicted 1540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005508
ARHGAP30 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 30
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000105725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005508.1-3937s1c1
Sequence:CCGGCCCTGATTTGTTCCTAGATTTCTCGAGAAATCTAGGAACAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005508.1-1327s1c1
Sequence:CCGGCCTGAGAGTTTGGAGAGTAATCTCGAGATTACTCTCCAAACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005508.1-631s1c1
Sequence:CCGGCGATTGGTCAAGATCCTAGAACTCGAGTTCTAGGATCTTGACCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005508.1-3341s1c1
Sequence:CCGGGCATGATCCTTGCCCATTCTTCTCGAGAAGAATGGGCAAGGATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005508
ARHGAP30 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 30
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000105725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005508.1-3937s1c1
Sequence:CCGGCCCTGATTTGTTCCTAGATTTCTCGAGAAATCTAGGAACAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005508.1-1327s1c1
Sequence:CCGGCCTGAGAGTTTGGAGAGTAATCTCGAGATTACTCTCCAAACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005508.1-631s1c1
Sequence:CCGGCGATTGGTCAAGATCCTAGAACTCGAGTTCTAGGATCTTGACCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005508.1-3341s1c1
Sequence:CCGGGCATGATCCTTGCCCATTCTTCTCGAGAAGAATGGGCAAGGATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005508
ARHGAP30 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 30
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000105725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005508.1-3937s1c1
Sequence:CCGGCCCTGATTTGTTCCTAGATTTCTCGAGAAATCTAGGAACAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005508.1-1327s1c1
Sequence:CCGGCCTGAGAGTTTGGAGAGTAATCTCGAGATTACTCTCCAAACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005508.1-631s1c1
Sequence:CCGGCGATTGGTCAAGATCCTAGAACTCGAGTTCTAGGATCTTGACCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005508.1-3341s1c1
Sequence:CCGGGCATGATCCTTGCCCATTCTTCTCGAGAAGAATGGGCAAGGATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181720
ARHGAP30 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 30
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181720.1-2658s1c1
Sequence:CCGGGCGCAGATCATATGCATTTGACTCGAGTCAAATGCATATGATCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181720.1-846s1c1
Sequence:CCGGCTACCATACTATCATCGAGATCTCGAGATCTCGATGATAGTATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181720.1-2660s1c1
Sequence:CCGGGCAGATCATATGCATTTGAAACTCGAGTTTCAAATGCATATGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181720.1-1116s1c1
Sequence:CCGGGAGCTTGGAGAACGATTCTATCTCGAGATAGAATCGTTCTCCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-620s21c1
Sequence:CCGGTCCCTGTGCAAGGCCTATTTCCTCGAGGAAATAGGCCTTGCACAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181720.2-3442s21c1
Sequence:CCGGAGAGTTGCCCATTCCTGTTATCTCGAGATAACAGGAATGGGCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-1241s21c1
Sequence:CCGGGGCCATGAGACTAAGCGTAAACTCGAGTTTACGCTTAGTCTCATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-1276s21c1
Sequence:CCGGTGAGGACAGGGAGGATAAATCCTCGAGGATTTATCCTCCCTGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-588s21c1
Sequence:CCGGATGTTTACCTCCAAGACATTCCTCGAGGAATGTCTTGGAGGTAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-1211s21c1
Sequence:CCGGTGGAGGTCTATCTTCAATTTACTCGAGTAAATTGAAGATAGACCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181720
ARHGAP30 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 30
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181720.1-2658s1c1
Sequence:CCGGGCGCAGATCATATGCATTTGACTCGAGTCAAATGCATATGATCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181720.1-846s1c1
Sequence:CCGGCTACCATACTATCATCGAGATCTCGAGATCTCGATGATAGTATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181720.1-2660s1c1
Sequence:CCGGGCAGATCATATGCATTTGAAACTCGAGTTTCAAATGCATATGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181720.1-1116s1c1
Sequence:CCGGGAGCTTGGAGAACGATTCTATCTCGAGATAGAATCGTTCTCCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-620s21c1
Sequence:CCGGTCCCTGTGCAAGGCCTATTTCCTCGAGGAAATAGGCCTTGCACAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181720.2-3442s21c1
Sequence:CCGGAGAGTTGCCCATTCCTGTTATCTCGAGATAACAGGAATGGGCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-1241s21c1
Sequence:CCGGGGCCATGAGACTAAGCGTAAACTCGAGTTTACGCTTAGTCTCATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-1276s21c1
Sequence:CCGGTGAGGACAGGGAGGATAAATCCTCGAGGATTTATCCTCCCTGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-588s21c1
Sequence:CCGGATGTTTACCTCCAAGACATTCCTCGAGGAATGTCTTGGAGGTAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-1211s21c1
Sequence:CCGGTGGAGGTCTATCTTCAATTTACTCGAGTAAATTGAAGATAGACCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181720
ARHGAP30 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 30
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181720.1-2658s1c1
Sequence:CCGGGCGCAGATCATATGCATTTGACTCGAGTCAAATGCATATGATCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181720.1-846s1c1
Sequence:CCGGCTACCATACTATCATCGAGATCTCGAGATCTCGATGATAGTATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181720.1-2660s1c1
Sequence:CCGGGCAGATCATATGCATTTGAAACTCGAGTTTCAAATGCATATGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181720.1-1116s1c1
Sequence:CCGGGAGCTTGGAGAACGATTCTATCTCGAGATAGAATCGTTCTCCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-620s21c1
Sequence:CCGGTCCCTGTGCAAGGCCTATTTCCTCGAGGAAATAGGCCTTGCACAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181720.2-3442s21c1
Sequence:CCGGAGAGTTGCCCATTCCTGTTATCTCGAGATAACAGGAATGGGCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-1241s21c1
Sequence:CCGGGGCCATGAGACTAAGCGTAAACTCGAGTTTACGCTTAGTCTCATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-1276s21c1
Sequence:CCGGTGAGGACAGGGAGGATAAATCCTCGAGGATTTATCCTCCCTGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-588s21c1
Sequence:CCGGATGTTTACCTCCAAGACATTCCTCGAGGAATGTCTTGGAGGTAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181720.2-1211s21c1
Sequence:CCGGTGGAGGTCTATCTTCAATTTACTCGAGTAAATTGAAGATAGACCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks