EMAIL THIS PAGE TO A FRIEND

ARHGAP31

Rho GTPase activating protein 31

117 Gene Product Result for
Synonyms: AOS1 CDGAP
UniProtKB ID: Q2M1Z3, Q9ULL6
Gene ID:
Human(57514) Summary: This gene encodes a GTPase-activating protein (GAP). A variety of cellular processes are regulated by Rho GTPases which cycle between an inactive form bound to GDP and an active form bound to GTP. This cycling between inactive and active forms is regulated by guanine nucleotide exchange factors and GAPs. The encoded protein is a GAP shown to regulate two GTPases involved in protein trafficking and cell growth. [provided by RefSeq, Jul 2008]
Mouse(12549) Rho GTPase activating protein 31
Rat(288093) Rho GTPase activating protein 31
naked mole-rat(101707746) Rho GTPase activating protein 31
domestic guinea pig(100735829) Rho GTPase activating protein 31
sheep(101105202) Rho GTPase activating protein 31
Domestic Rabbit(100344586) Rho GTPase activating protein 31
Zebrafish(101885883) Rho GTPase activating protein 31
chicken(418344) Rho GTPase activating protein 31
dog(487992) Rho GTPase activating protein 31
Horse(100071056) Rho GTPase activating protein 31
cow(515490) Rho GTPase activating protein 31
domestic cat(101100584) Rho GTPase activating protein 31
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_291085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291085 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020754 Rosetta Predictions human pricing
NM_001105879 Rosetta Predictions rat pricing
NM_020260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118138 predicted 1622
2 SASI_Hs01_00118139 predicted 1606
3 SASI_Hs01_00118140 predicted 4322
4 SASI_Hs02_00353877 predicted 710
5 SASI_Hs01_00118142 predicted 4935
6 SASI_Hs01_00118143 predicted 2576
7 SASI_Hs01_00118144 predicted 959
8 SASI_Hs01_00118145 predicted 738
9 SASI_Hs01_00118146 predicted 4847
10 SASI_Hs01_00118147 predicted 1056
11 SASI_Hs01_00118141 predicted 3517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105879 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213432 predicted 745
2 SASI_Rn02_00213433 predicted 2327
3 SASI_Rn02_00213434 predicted 3281
4 SASI_Rn02_00213435 predicted 364
5 SASI_Rn02_00213436 predicted 1087
6 SASI_Rn02_00213437 predicted 1289
7 SASI_Rn02_00213438 predicted 2848
8 SASI_Rn02_00213439 predicted 275
9 SASI_Rn02_00213440 predicted 653
10 SASI_Rn02_00213441 predicted 3260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181744 predicted 3420
2 SASI_Mm01_00181745 predicted 1083
3 SASI_Mm01_00181746 predicted 418
4 SASI_Mm01_00181747 predicted 3126
5 SASI_Mm01_00181748 predicted 1248
6 SASI_Mm01_00181749 predicted 921
7 SASI_Mm01_00181750 predicted 3840
8 SASI_Mm01_00181751 predicted 2457
9 SASI_Mm01_00181752 predicted 4426
10 SASI_Mm01_00181753 predicted 880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020260
ARHGAP31 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 31
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020260.2-2844s1c1
Sequence:CCGGGCAAGCCCAAATGAGAAGCAACTCGAGTTGCTTCTCATTTGGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020260.2-4355s1c1
Sequence:CCGGCCTAATCTTATTCCCTATCATCTCGAGATGATAGGGAATAAGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020260.2-1037s1c1
Sequence:CCGGGCAGGATGAAAGCCGTACTATCTCGAGATAGTACGGCTTTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020260.2-4960s1c1
Sequence:CCGGGCCTCCATTATCATTCTCTTACTCGAGTAAGAGAATGATAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020260.2-4559s1c1
Sequence:CCGGCGAGACTTCGACAAGCTGTTTCTCGAGAAACAGCTTGTCGAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020260
ARHGAP31 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 31
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020260.2-2844s1c1
Sequence:CCGGGCAAGCCCAAATGAGAAGCAACTCGAGTTGCTTCTCATTTGGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020260.2-4355s1c1
Sequence:CCGGCCTAATCTTATTCCCTATCATCTCGAGATGATAGGGAATAAGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020260.2-1037s1c1
Sequence:CCGGGCAGGATGAAAGCCGTACTATCTCGAGATAGTACGGCTTTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020260.2-4960s1c1
Sequence:CCGGGCCTCCATTATCATTCTCTTACTCGAGTAAGAGAATGATAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020260.2-4559s1c1
Sequence:CCGGCGAGACTTCGACAAGCTGTTTCTCGAGAAACAGCTTGTCGAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020260
ARHGAP31 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 31
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020260.2-2844s1c1
Sequence:CCGGGCAAGCCCAAATGAGAAGCAACTCGAGTTGCTTCTCATTTGGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020260.2-4355s1c1
Sequence:CCGGCCTAATCTTATTCCCTATCATCTCGAGATGATAGGGAATAAGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020260.2-1037s1c1
Sequence:CCGGGCAGGATGAAAGCCGTACTATCTCGAGATAGTACGGCTTTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020260.2-4960s1c1
Sequence:CCGGGCCTCCATTATCATTCTCTTACTCGAGTAAGAGAATGATAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020260.2-4559s1c1
Sequence:CCGGCGAGACTTCGACAAGCTGTTTCTCGAGAAACAGCTTGTCGAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291085
ARHGAP31 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 31
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-714s1c1
Sequence:CCGGCCTCAAACATACAACGGCTAACTCGAGTTAGCCGTTGTATGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-4820s1c1
Sequence:CCGGCGGAGATCAGTAATTCTGGATCTCGAGATCCAGAATTACTGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-2825s1c1
Sequence:CCGGCCACAAGCAACAGTGGAAGTACTCGAGTACTTCCACTGTTGCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-3906s1c1
Sequence:CCGGCCTCATTTAGTTCACCTGGAACTCGAGTTCCAGGTGAACTAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-1420s1c1
Sequence:CCGGGCTCTCCAGTAAATCAAAGAACTCGAGTTCTTTGATTTACTGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291085
ARHGAP31 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 31
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-714s1c1
Sequence:CCGGCCTCAAACATACAACGGCTAACTCGAGTTAGCCGTTGTATGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-4820s1c1
Sequence:CCGGCGGAGATCAGTAATTCTGGATCTCGAGATCCAGAATTACTGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-2825s1c1
Sequence:CCGGCCACAAGCAACAGTGGAAGTACTCGAGTACTTCCACTGTTGCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-3906s1c1
Sequence:CCGGCCTCATTTAGTTCACCTGGAACTCGAGTTCCAGGTGAACTAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-1420s1c1
Sequence:CCGGGCTCTCCAGTAAATCAAAGAACTCGAGTTCTTTGATTTACTGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291085
ARHGAP31 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 31
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-714s1c1
Sequence:CCGGCCTCAAACATACAACGGCTAACTCGAGTTAGCCGTTGTATGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-4820s1c1
Sequence:CCGGCGGAGATCAGTAATTCTGGATCTCGAGATCCAGAATTACTGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-2825s1c1
Sequence:CCGGCCACAAGCAACAGTGGAAGTACTCGAGTACTTCCACTGTTGCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-3906s1c1
Sequence:CCGGCCTCATTTAGTTCACCTGGAACTCGAGTTCCAGGTGAACTAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291085.1-1420s1c1
Sequence:CCGGGCTCTCCAGTAAATCAAAGAACTCGAGTTCTTTGATTTACTGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks