EMAIL THIS PAGE TO A FRIEND

ARHGAP32

Rho GTPase activating protein 32

82 Gene Product Result for
Synonyms: GC-GAP GRIT PX-RICS RICS p200RhoGAP p250GAP
UniProtKB ID: A7KAX9, O94820, Q86YL6, Q8IUG4, Q9BWG3
Gene ID:
Human(9743) Summary: RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]
Mouse(330914) Rho GTPase activating protein 32
Rat(315530) Rho GTPase activating protein 32
chicken(419724) Rho GTPase activating protein 32
dog(489283) Rho GTPase activating protein 32
domestic cat(101091969) Rho GTPase activating protein 32
cow(506260) Rho GTPase activating protein 32
sheep(101116614) Rho GTPase activating protein 32
Domestic Rabbit(100337871) Rho GTPase activating protein 32
domestic guinea pig(100722272) Rho GTPase activating protein 32
naked mole-rat(101722968) Rho GTPase activating protein 32
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014715 Rosetta Predictions human pricing
XM_001056872 Rosetta Predictions rat pricing
XM_236020 Rosetta Predictions rat pricing
NM_177379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027036 predicted 1968
2 SASI_Hs01_00027037 predicted 779
3 SASI_Hs01_00027038 predicted 2773
4 SASI_Hs02_00346140 predicted 5062
5 SASI_Hs01_00027039 predicted 2247
6 SASI_Hs01_00027040 predicted 3217
7 SASI_Hs01_00027041 predicted 671
8 SASI_Hs01_00027042 predicted 2375
9 SASI_Hs01_00027043 predicted 1287
10 SASI_Hs01_00027044 predicted 2637
11 SASI_Hs01_00027045 predicted 2474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056872 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284723 predicted 1252
2 SASI_Rn02_00284724 predicted 5041
3 SASI_Rn02_00284725 predicted 5831
4 SASI_Rn02_00284726 predicted 2651
5 SASI_Rn02_00284727 predicted 5583
6 SASI_Rn02_00284728 predicted 6443
7 SASI_Rn02_00284729 predicted 2317
8 SASI_Rn02_00284730 predicted 6094
9 SASI_Rn02_00284731 predicted 913
10 SASI_Rn02_00284732 predicted 3359
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389823 predicted 611
2 SASI_Rn02_00389824 predicted 4188
3 SASI_Rn02_00389825 predicted 4990
4 SASI_Rn02_00389826 predicted 271
5 SASI_Rn02_00389827 predicted 1796
6 SASI_Rn02_00389828 predicted 4734
7 SASI_Rn02_00389829 predicted 5595
8 SASI_Rn02_00389830 predicted 1456
9 SASI_Rn02_00389831 predicted 5244
10 SASI_Rn02_00389832 predicted 2507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049432 predicted 836
2 SASI_Mm01_00049433 predicted 2513
3 SASI_Mm01_00049434 predicted 2388
4 SASI_Mm01_00049435 predicted 3804
5 SASI_Mm01_00049436 predicted 2182
6 SASI_Mm01_00049437 predicted 1080
7 SASI_Mm01_00049438 predicted 253
8 SASI_Mm01_00049440 predicted 1526
9 SASI_Mm01_00049441 predicted 3925
10 SASI_Mm02_00347557 predicted 4777
11 SASI_Mm01_00049439 predicted 4712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014715
ARHGAP32 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 32
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-2965s1c1
Sequence:CCGGCCTCCTAATTTACCTAGCGATCTCGAGATCGCTAGGTAAATTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-384s1c1
Sequence:CCGGGCACCTTCTAAATTCTGGTTTCTCGAGAAACCAGAATTTAGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-3560s1c1
Sequence:CCGGCCAGCAGTTCAAATTATCATTCTCGAGAATGATAATTTGAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-4962s1c1
Sequence:CCGGCCAGTTAGATTATGGGTCCAACTCGAGTTGGACCCATAATCTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-490s1c1
Sequence:CCGGGCCTCCAATATCCAGAGACTACTCGAGTAGTCTCTGGATATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014715.3-2008s21c1
Sequence:CCGGTCCGAAGATAGGACGGAAATTCTCGAGAATTTCCGTCCTATCTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014715
ARHGAP32 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 32
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-2965s1c1
Sequence:CCGGCCTCCTAATTTACCTAGCGATCTCGAGATCGCTAGGTAAATTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-384s1c1
Sequence:CCGGGCACCTTCTAAATTCTGGTTTCTCGAGAAACCAGAATTTAGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-3560s1c1
Sequence:CCGGCCAGCAGTTCAAATTATCATTCTCGAGAATGATAATTTGAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-4962s1c1
Sequence:CCGGCCAGTTAGATTATGGGTCCAACTCGAGTTGGACCCATAATCTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-490s1c1
Sequence:CCGGGCCTCCAATATCCAGAGACTACTCGAGTAGTCTCTGGATATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014715.3-2008s21c1
Sequence:CCGGTCCGAAGATAGGACGGAAATTCTCGAGAATTTCCGTCCTATCTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014715
ARHGAP32 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 32
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-2965s1c1
Sequence:CCGGCCTCCTAATTTACCTAGCGATCTCGAGATCGCTAGGTAAATTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-384s1c1
Sequence:CCGGGCACCTTCTAAATTCTGGTTTCTCGAGAAACCAGAATTTAGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-3560s1c1
Sequence:CCGGCCAGCAGTTCAAATTATCATTCTCGAGAATGATAATTTGAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-4962s1c1
Sequence:CCGGCCAGTTAGATTATGGGTCCAACTCGAGTTGGACCCATAATCTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014715.2-490s1c1
Sequence:CCGGGCCTCCAATATCCAGAGACTACTCGAGTAGTCTCTGGATATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014715.3-2008s21c1
Sequence:CCGGTCCGAAGATAGGACGGAAATTCTCGAGAATTTCCGTCCTATCTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177379
VALIDATED
ARHGAP32 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 32
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177379.2-1301s1c1
Sequence:CCGGCCGGTGCAATTCCTATGACAACTCGAGTTGTCATAGGAATTGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177379.2-484s1c1
Sequence:CCGGCGGATGAAGAACGGTTGATAACTCGAGTTATCAACCGTTCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177379.2-2396s1c1
Sequence:CCGGGCAGATCAATGGACTCGGAAACTCGAGTTTCCGAGTCCATTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177379.2-3548s1c1
Sequence:CCGGGCATTTCAATATGACTCCAAACTCGAGTTTGGAGTCATATTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177379.2-1302s1c1
Sequence:CCGGCGGTGCAATTCCTATGACAATCTCGAGATTGTCATAGGAATTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177379
VALIDATED
ARHGAP32 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 32
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177379.2-1301s1c1
Sequence:CCGGCCGGTGCAATTCCTATGACAACTCGAGTTGTCATAGGAATTGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177379.2-484s1c1
Sequence:CCGGCGGATGAAGAACGGTTGATAACTCGAGTTATCAACCGTTCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177379.2-2396s1c1
Sequence:CCGGGCAGATCAATGGACTCGGAAACTCGAGTTTCCGAGTCCATTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177379.2-3548s1c1
Sequence:CCGGGCATTTCAATATGACTCCAAACTCGAGTTTGGAGTCATATTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177379.2-1302s1c1
Sequence:CCGGCGGTGCAATTCCTATGACAATCTCGAGATTGTCATAGGAATTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177379
VALIDATED
ARHGAP32 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 32
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177379.2-1301s1c1
Sequence:CCGGCCGGTGCAATTCCTATGACAACTCGAGTTGTCATAGGAATTGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177379.2-484s1c1
Sequence:CCGGCGGATGAAGAACGGTTGATAACTCGAGTTATCAACCGTTCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177379.2-2396s1c1
Sequence:CCGGGCAGATCAATGGACTCGGAAACTCGAGTTTCCGAGTCCATTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177379.2-3548s1c1
Sequence:CCGGGCATTTCAATATGACTCCAAACTCGAGTTTGGAGTCATATTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177379.2-1302s1c1
Sequence:CCGGCGGTGCAATTCCTATGACAATCTCGAGATTGTCATAGGAATTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks