EMAIL THIS PAGE TO A FRIEND

ARHGAP33

Rho GTPase activating protein 33

Synonyms: NOMA-GAP SNX26 TCGAP
UniProtKB ID: O14559, O14552, O14560, Q6ZSP6, Q96CP3, Q9NT23
Gene ID:
Human(115703) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Alternative splice variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Mouse(233071) Rho GTPase activating protein 33
Rat(100362311) Rho GTPase activating protein 33
naked mole-rat(101702960) Rho GTPase activating protein 33
domestic guinea pig(100724917) Rho GTPase activating protein 33
sheep(101105098) Rho GTPase activating protein 33
dog(484573) Rho GTPase activating protein 33
Horse(100059898) Rho GTPase activating protein 33
cow(100138767) Rho GTPase activating protein 33
domestic cat(101101274) Rho GTPase activating protein 33
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052948 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052948 Rosetta Predictions human pricing
NM_178252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196601 predicted 258
2 SASI_Hs01_00196602 predicted 2504
3 SASI_Hs01_00196603 predicted 1384
4 SASI_Hs01_00196604 predicted 653
5 SASI_Hs01_00196605 predicted 232
6 SASI_Hs01_00196606 predicted 3507
7 SASI_Hs01_00196607 predicted 712
8 SASI_Hs01_00196608 predicted 2499
9 SASI_Hs01_00196610 predicted 1476
10 SASI_Hs02_00361743 predicted 889
11 SASI_Hs01_00196609 predicted 3575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348666 predicted 364
2 SASI_Mm01_00101026 predicted 3508
3 SASI_Mm01_00101027 predicted 1119
4 SASI_Mm01_00101028 predicted 783
5 SASI_Mm01_00101029 predicted 3022
6 SASI_Mm02_00348667 predicted 486
7 SASI_Mm01_00101031 predicted 3194
8 SASI_Mm01_00101033 predicted 345
9 SASI_Mm01_00101034 predicted 1437
10 SASI_Mm01_00101035 predicted 799
11 SASI_Mm01_00101030 predicted 821
12 SASI_Mm01_00101032 predicted 4132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178252
ARHGAP33 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 33
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-476s21c1
Sequence:GTACCGGCCTCCGGAGCTATGACGATTTCTCGAGAAATCGTCATAGCTCCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-525s21c1
Sequence:GTACCGGTGCATATTTGACCGGAGATTTCTCGAGAAATCTCCGGTCAAATATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-1184s21c1
Sequence:GTACCGGGCGCTGCTGCTCTGAGTTTATCTCGAGATAAACTCAGAGCAGCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-2784s21c1
Sequence:GTACCGGGGCATGGATTCACCGTTATTGCTCGAGCAATAACGGTGAATCCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-3419s21c1
Sequence:GTACCGGAGAGAATCTGTACTATGAAATCTCGAGATTTCATAGTACAGATTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178252.2-4122s1c1
Sequence:CCGGCCCAGGTTTCTAACTTTGTAACTCGAGTTACAAAGTTAGAAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178252.2-3917s1c1
Sequence:CCGGCCGAGGATCCTTGTACAGAAACTCGAGTTTCTGTACAAGGATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178252.2-345s1c1
Sequence:CCGGCACTATGAGAATGTTGACTTTCTCGAGAAAGTCAACATTCTCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178252.2-344s1c1
Sequence:CCGGCCACTATGAGAATGTTGACTTCTCGAGAAGTCAACATTCTCATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178252.2-2783s1c1
Sequence:CCGGCGGCATGGATTCACCGTTATTCTCGAGAATAACGGTGAATCCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178252
ARHGAP33 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 33
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-476s21c1
Sequence:GTACCGGCCTCCGGAGCTATGACGATTTCTCGAGAAATCGTCATAGCTCCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-525s21c1
Sequence:GTACCGGTGCATATTTGACCGGAGATTTCTCGAGAAATCTCCGGTCAAATATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-1184s21c1
Sequence:GTACCGGGCGCTGCTGCTCTGAGTTTATCTCGAGATAAACTCAGAGCAGCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-2784s21c1
Sequence:GTACCGGGGCATGGATTCACCGTTATTGCTCGAGCAATAACGGTGAATCCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-3419s21c1
Sequence:GTACCGGAGAGAATCTGTACTATGAAATCTCGAGATTTCATAGTACAGATTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178252.2-4122s1c1
Sequence:CCGGCCCAGGTTTCTAACTTTGTAACTCGAGTTACAAAGTTAGAAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178252.2-3917s1c1
Sequence:CCGGCCGAGGATCCTTGTACAGAAACTCGAGTTTCTGTACAAGGATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178252.2-345s1c1
Sequence:CCGGCACTATGAGAATGTTGACTTTCTCGAGAAAGTCAACATTCTCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178252.2-344s1c1
Sequence:CCGGCCACTATGAGAATGTTGACTTCTCGAGAAGTCAACATTCTCATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178252.2-2783s1c1
Sequence:CCGGCGGCATGGATTCACCGTTATTCTCGAGAATAACGGTGAATCCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178252
ARHGAP33 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 33
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-476s21c1
Sequence:GTACCGGCCTCCGGAGCTATGACGATTTCTCGAGAAATCGTCATAGCTCCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-525s21c1
Sequence:GTACCGGTGCATATTTGACCGGAGATTTCTCGAGAAATCTCCGGTCAAATATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-1184s21c1
Sequence:GTACCGGGCGCTGCTGCTCTGAGTTTATCTCGAGATAAACTCAGAGCAGCAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-2784s21c1
Sequence:GTACCGGGGCATGGATTCACCGTTATTGCTCGAGCAATAACGGTGAATCCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178252.2-3419s21c1
Sequence:GTACCGGAGAGAATCTGTACTATGAAATCTCGAGATTTCATAGTACAGATTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178252.2-4122s1c1
Sequence:CCGGCCCAGGTTTCTAACTTTGTAACTCGAGTTACAAAGTTAGAAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178252.2-3917s1c1
Sequence:CCGGCCGAGGATCCTTGTACAGAAACTCGAGTTTCTGTACAAGGATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178252.2-345s1c1
Sequence:CCGGCACTATGAGAATGTTGACTTTCTCGAGAAAGTCAACATTCTCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178252.2-344s1c1
Sequence:CCGGCCACTATGAGAATGTTGACTTCTCGAGAAGTCAACATTCTCATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178252.2-2783s1c1
Sequence:CCGGCGGCATGGATTCACCGTTATTCTCGAGAATAACGGTGAATCCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052948
VALIDATED
ARHGAP33 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 33
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052948.2-3599s21c1
Sequence:CCGGTGTGGGTCCCTAACCTATAATCTCGAGATTATAGGTTAGGGACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052948.2-657s21c1
Sequence:CCGGCCCATGTGATCAAACGGTATACTCGAGTATACCGTTTGATCACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052948.2-618s21c1
Sequence:CCGGGTGAGGAGGCGTCACTCAATACTCGAGTATTGAGTGACGCCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052948.2-375s21c1
Sequence:CCGGTCCGGAGTTACGATGACTTTCCTCGAGGAAAGTCATCGTAACTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052948.2-243s21c1
Sequence:CCGGACTACGAGAACGTTGACTTTGCTCGAGCAAAGTCAACGTTCTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052948.2-3350s1c1
Sequence:CCGGCGAGGGTCCTTGTACAGAAATCTCGAGATTTCTGTACAAGGACCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052948.2-3104s1c1
Sequence:CCGGCTCTACGTCAACCTAGCTCTACTCGAGTAGAGCTAGGTTGACGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052948.2-374s1c1
Sequence:CCGGCTCCGGAGTTACGATGACTTTCTCGAGAAAGTCATCGTAACTCCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052948.2-377s1c1
Sequence:CCGGCGGAGTTACGATGACTTTCGTCTCGAGACGAAAGTCATCGTAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_052948.2-656s1c1
Sequence:CCGGGCCCATGTGATCAAACGGTATCTCGAGATACCGTTTGATCACATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_052948.2-3607s1c1
Sequence:CCGGCCTAACCTATAATCTCAGCTTCTCGAGAAGCTGAGATTATAGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052948.2-3567s1c1
Sequence:CCGGCCCAGGTTTCTAACTTTGTAACTCGAGTTACAAAGTTAGAAACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052948.2-3612s1c1
Sequence:CCGGCCTATAATCTCAGCTTCCCTACTCGAGTAGGGAAGCTGAGATTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052948.2-421s1c1
Sequence:CCGGGTGCATATTTGACCGGAGGTTCTCGAGAACCTCCGGTCAAATATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052948
VALIDATED
ARHGAP33 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 33
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052948.2-3599s21c1
Sequence:CCGGTGTGGGTCCCTAACCTATAATCTCGAGATTATAGGTTAGGGACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052948.2-657s21c1
Sequence:CCGGCCCATGTGATCAAACGGTATACTCGAGTATACCGTTTGATCACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052948.2-618s21c1
Sequence:CCGGGTGAGGAGGCGTCACTCAATACTCGAGTATTGAGTGACGCCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052948.2-375s21c1
Sequence:CCGGTCCGGAGTTACGATGACTTTCCTCGAGGAAAGTCATCGTAACTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052948.2-243s21c1
Sequence:CCGGACTACGAGAACGTTGACTTTGCTCGAGCAAAGTCAACGTTCTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052948.2-3350s1c1
Sequence:CCGGCGAGGGTCCTTGTACAGAAATCTCGAGATTTCTGTACAAGGACCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052948.2-3104s1c1
Sequence:CCGGCTCTACGTCAACCTAGCTCTACTCGAGTAGAGCTAGGTTGACGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052948.2-374s1c1
Sequence:CCGGCTCCGGAGTTACGATGACTTTCTCGAGAAAGTCATCGTAACTCCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052948.2-377s1c1
Sequence:CCGGCGGAGTTACGATGACTTTCGTCTCGAGACGAAAGTCATCGTAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_052948.2-656s1c1
Sequence:CCGGGCCCATGTGATCAAACGGTATCTCGAGATACCGTTTGATCACATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_052948.2-3607s1c1
Sequence:CCGGCCTAACCTATAATCTCAGCTTCTCGAGAAGCTGAGATTATAGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052948.2-3567s1c1
Sequence:CCGGCCCAGGTTTCTAACTTTGTAACTCGAGTTACAAAGTTAGAAACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052948.2-3612s1c1
Sequence:CCGGCCTATAATCTCAGCTTCCCTACTCGAGTAGGGAAGCTGAGATTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052948.2-421s1c1
Sequence:CCGGGTGCATATTTGACCGGAGGTTCTCGAGAACCTCCGGTCAAATATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052948
VALIDATED
ARHGAP33 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 33
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052948.2-3599s21c1
Sequence:CCGGTGTGGGTCCCTAACCTATAATCTCGAGATTATAGGTTAGGGACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052948.2-657s21c1
Sequence:CCGGCCCATGTGATCAAACGGTATACTCGAGTATACCGTTTGATCACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052948.2-618s21c1
Sequence:CCGGGTGAGGAGGCGTCACTCAATACTCGAGTATTGAGTGACGCCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052948.2-375s21c1
Sequence:CCGGTCCGGAGTTACGATGACTTTCCTCGAGGAAAGTCATCGTAACTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052948.2-243s21c1
Sequence:CCGGACTACGAGAACGTTGACTTTGCTCGAGCAAAGTCAACGTTCTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052948.2-3350s1c1
Sequence:CCGGCGAGGGTCCTTGTACAGAAATCTCGAGATTTCTGTACAAGGACCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052948.2-3104s1c1
Sequence:CCGGCTCTACGTCAACCTAGCTCTACTCGAGTAGAGCTAGGTTGACGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052948.2-374s1c1
Sequence:CCGGCTCCGGAGTTACGATGACTTTCTCGAGAAAGTCATCGTAACTCCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052948.2-377s1c1
Sequence:CCGGCGGAGTTACGATGACTTTCGTCTCGAGACGAAAGTCATCGTAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_052948.2-656s1c1
Sequence:CCGGGCCCATGTGATCAAACGGTATCTCGAGATACCGTTTGATCACATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_052948.2-3607s1c1
Sequence:CCGGCCTAACCTATAATCTCAGCTTCTCGAGAAGCTGAGATTATAGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052948.2-3567s1c1
Sequence:CCGGCCCAGGTTTCTAACTTTGTAACTCGAGTTACAAAGTTAGAAACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052948.2-3612s1c1
Sequence:CCGGCCTATAATCTCAGCTTCCCTACTCGAGTAGGGAAGCTGAGATTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052948.2-421s1c1
Sequence:CCGGGTGCATATTTGACCGGAGGTTCTCGAGAACCTCCGGTCAAATATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks