EMAIL THIS PAGE TO A FRIEND

ARHGAP35

Rho GTPase activating protein 35

101 Gene Product Result for
Synonyms: GRF-1 GRLF1 P190-A P190A p190ARhoGAP p190RhoGAP
UniProtKB ID: Q9NRY4, A7E2A4, Q14452, Q9C0E1
Gene ID:
Human(2909) Summary: The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
Rat(306400) Rho GTPase activating protein 35
Zebrafish(564565) Rho GTPase activating protein 35b
cow(540310) Rho GTPase activating protein 35
chicken(425730) Rho GTPase activating protein 35
dog(403543) Rho GTPase activating protein 35
domestic cat(101089912) Rho GTPase activating protein 35
sheep(101117354) Rho GTPase activating protein 35
domestic guinea pig(100718086) Rho GTPase activating protein 35
naked mole-rat(101719355) Rho GTPase activating protein 35
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA055184 Anti-ARHGAP35 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA056470 Anti-ARHGAP35 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4501313 Anti-GRF-1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
R2654 Anti-p190 RhoGAP (GK-18) antibody produced in rabbit ~0.8 mg/mL, affinity isolated antibody, buffered aqueous solution canine, mouse, human
immunoprecipitation, western blot pricing
SAB4503875 Anti-phospho-GRF-1 (pTyr1105) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301505 Anti-phospho-GRF-1 (pTyr1105) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
WH0002909M1 Monoclonal Anti-GRLF1 antibody produced in mouse clone 4D4-F8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
R3150 Monoclonal Anti-RhoGAP (p190) antibody produced in mouse clone D2D6, purified immunoglobulin, buffered aqueous solution mouse, monkey, human, rat
immunoprecipitation, western blot pricing
PLA0210 Rabbit anti-GRLF1/p190RhoGAP Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. dog, primate, human, guinea pig, gorilla, mouse, rat, rhesus monkey, bovine, horse, pig
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004491 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146061 MISSION® esiRNA esiRNA human GRLF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004491 Rosetta Predictions human pricing
XM_001053554 Rosetta Predictions rat pricing
XM_224781 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337730 predicted 2739
2 SASI_Hs01_00090746 predicted 2968
3 SASI_Hs01_00090747 predicted 3994
4 SASI_Hs02_00337731 predicted 578
5 SASI_Hs01_00090748 predicted 2638
6 SASI_Hs01_00090750 predicted 1044
7 SASI_Hs01_00090751 predicted 595
8 SASI_Hs01_00090753 predicted 1694
9 SASI_Hs02_00337732 predicted 720
10 SASI_Hs01_00090754 predicted 1808
11 SASI_Hs01_00090749 predicted 1839
12 SASI_Hs01_00090752 predicted 2835
13 SASI_Hs01_00090755 predicted 2665
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272754 predicted 1296
2 SASI_Rn02_00272755 predicted 1238
3 SASI_Rn02_00272756 predicted 1634
4 SASI_Rn02_00272757 predicted 2459
5 SASI_Rn02_00272758 predicted 2193
6 SASI_Rn02_00272759 predicted 2247
7 SASI_Rn02_00272760 predicted 3522
8 SASI_Rn02_00272761 predicted 477
9 SASI_Rn02_00272762 predicted 3533
10 SASI_Rn02_00272763 predicted 3716
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151665 predicted 720
2 SASI_Rn01_00151666 predicted 539
3 SASI_Rn01_00151667 predicted 1472
4 SASI_Rn01_00151668 predicted 1410
5 SASI_Rn01_00151669 predicted 1087
6 SASI_Rn01_00151670 predicted 401
7 SASI_Rn01_00151671 predicted 1230
8 SASI_Rn01_00151672 predicted 715
9 SASI_Rn01_00151673 predicted 707
10 SASI_Rn01_00151674 predicted 1451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004491
VALIDATED
ARHGAP35 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 35
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004491.2-1627s1c1
Sequence:CCGGGCCCTTATTCTGAAACACATTCTCGAGAATGTGTTTCAGAATAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004491.2-4266s1c1
Sequence:CCGGCCAGACAATCATTGAACTCTTCTCGAGAAGAGTTCAATGATTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004491.2-2068s1c1
Sequence:CCGGCGGGATAATCATTTAGTCCATCTCGAGATGGACTAAATGATTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004491.2-622s1c1
Sequence:CCGGCGGTACATTAGAGATGCACATCTCGAGATGTGCATCTCTAATGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004491.4-622s21c1
Sequence:CCGGCGGTACATTAGAGATGCACATCTCGAGATGTGCATCTCTAATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004491.4-1624s21c1
Sequence:CCGGGCCCTTATTCTGAAACACATTCTCGAGAATGTGTTTCAGAATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004491.4-2838s21c1
Sequence:CCGGCATAATCGAGGCTACTCATATCTCGAGATATGAGTAGCCTCGATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004491.4-4702s21c1
Sequence:CCGGTGAGCTGGCTTGGACCCATTTCTCGAGAAATGGGTCCAAGCCAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004491.4-2548s21c1
Sequence:CCGGCGGTTGGTTCATGGGTACATTCTCGAGAATGTACCCATGAACCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004491
VALIDATED
ARHGAP35 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 35
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004491.2-1627s1c1
Sequence:CCGGGCCCTTATTCTGAAACACATTCTCGAGAATGTGTTTCAGAATAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004491.2-4266s1c1
Sequence:CCGGCCAGACAATCATTGAACTCTTCTCGAGAAGAGTTCAATGATTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004491.2-2068s1c1
Sequence:CCGGCGGGATAATCATTTAGTCCATCTCGAGATGGACTAAATGATTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004491.2-622s1c1
Sequence:CCGGCGGTACATTAGAGATGCACATCTCGAGATGTGCATCTCTAATGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004491.4-622s21c1
Sequence:CCGGCGGTACATTAGAGATGCACATCTCGAGATGTGCATCTCTAATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004491.4-1624s21c1
Sequence:CCGGGCCCTTATTCTGAAACACATTCTCGAGAATGTGTTTCAGAATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004491.4-2838s21c1
Sequence:CCGGCATAATCGAGGCTACTCATATCTCGAGATATGAGTAGCCTCGATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004491.4-4702s21c1
Sequence:CCGGTGAGCTGGCTTGGACCCATTTCTCGAGAAATGGGTCCAAGCCAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004491.4-2548s21c1
Sequence:CCGGCGGTTGGTTCATGGGTACATTCTCGAGAATGTACCCATGAACCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004491
VALIDATED
ARHGAP35 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 35
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004491.2-1627s1c1
Sequence:CCGGGCCCTTATTCTGAAACACATTCTCGAGAATGTGTTTCAGAATAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004491.2-4266s1c1
Sequence:CCGGCCAGACAATCATTGAACTCTTCTCGAGAAGAGTTCAATGATTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004491.2-2068s1c1
Sequence:CCGGCGGGATAATCATTTAGTCCATCTCGAGATGGACTAAATGATTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004491.2-622s1c1
Sequence:CCGGCGGTACATTAGAGATGCACATCTCGAGATGTGCATCTCTAATGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004491.4-622s21c1
Sequence:CCGGCGGTACATTAGAGATGCACATCTCGAGATGTGCATCTCTAATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004491.4-1624s21c1
Sequence:CCGGGCCCTTATTCTGAAACACATTCTCGAGAATGTGTTTCAGAATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004491.4-2838s21c1
Sequence:CCGGCATAATCGAGGCTACTCATATCTCGAGATATGAGTAGCCTCGATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004491.4-4702s21c1
Sequence:CCGGTGAGCTGGCTTGGACCCATTTCTCGAGAAATGGGTCCAAGCCAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004491.4-2548s21c1
Sequence:CCGGCGGTTGGTTCATGGGTACATTCTCGAGAATGTACCCATGAACCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks