EMAIL THIS PAGE TO A FRIEND

ARHGAP36

Rho GTPase activating protein 36

137 Gene Product Result for
Gene ID:
Mouse(75404) Rho GTPase activating protein 36
Rat(302819) Rho GTPase activating protein 36
naked mole-rat(101704626) Rho GTPase activating protein 36
domestic guinea pig(100729211) Rho GTPase activating protein 36
sheep(100913153) Rho GTPase activating protein 36
domestic cat(101083752) Rho GTPase activating protein 36
cow(514137) Rho GTPase activating protein 36
dog(492137) Rho GTPase activating protein 36
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144967 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081123 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081123 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081123 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144967 Rosetta Predictions human pricing
XM_001069533 Rosetta Predictions rat pricing
XM_229133 Rosetta Predictions rat pricing
NM_001081123 Rosetta Predictions mouse pricing
XM_135854 Rosetta Predictions mouse pricing
XM_897584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364758 predicted 1563
2 SASI_Hs01_00089881 predicted 2061
3 SASI_Hs01_00089882 predicted 626
4 SASI_Hs01_00089883 predicted 562
5 SASI_Hs01_00089884 predicted 1433
6 SASI_Hs01_00089885 predicted 1704
7 SASI_Hs01_00089886 predicted 1648
8 SASI_Hs01_00089887 predicted 1514
9 SASI_Hs01_00089888 predicted 1364
10 SASI_Hs01_00089889 predicted 654
11 SASI_Hs01_00089880 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328401 predicted 1728
2 SASI_Rn02_00328402 predicted 1257
3 SASI_Rn02_00328403 predicted 600
4 SASI_Rn02_00328404 predicted 1266
5 SASI_Rn02_00328405 predicted 1155
6 SASI_Rn02_00328406 predicted 1351
7 SASI_Rn02_00328407 predicted 1994
8 SASI_Rn02_00328408 predicted 1639
9 SASI_Rn02_00328409 predicted 1352
10 SASI_Rn02_00328410 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385820 predicted 332
2 SASI_Rn02_00385821 predicted 729
3 SASI_Rn02_00385822 predicted 269
4 SASI_Rn02_00385823 predicted 707
5 SASI_Rn02_00385824 predicted 508
6 SASI_Rn02_00385825 predicted 572
7 SASI_Rn02_00385826 predicted 450
8 SASI_Rn02_00385827 predicted 520
9 SASI_Rn02_00385828 predicted 362
10 SASI_Rn02_00385829 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081123 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295411 predicted 1615
2 SASI_Mm02_00295412 predicted 1999
3 SASI_Mm02_00295413 predicted 1717
4 SASI_Mm02_00295414 predicted 963
5 SASI_Mm02_00295415 predicted 836
6 SASI_Mm02_00295416 predicted 572
7 SASI_Mm02_00295417 predicted 1328
8 SASI_Mm02_00295418 predicted 1139
9 SASI_Mm02_00295419 predicted 1477
10 SASI_Mm02_00295420 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242113 predicted 1622
2 SASI_Mm01_00242114 predicted 1998
3 SASI_Mm01_00242115 predicted 1715
4 SASI_Mm01_00242116 predicted 974
5 SASI_Mm01_00242117 predicted 845
6 SASI_Mm01_00242118 predicted 572
7 SASI_Mm01_00242119 predicted 1336
8 SASI_Mm01_00242120 predicted 1146
9 SASI_Mm01_00242121 predicted 1477
10 SASI_Mm01_00242122 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284006 predicted 806
2 SASI_Mm01_00284007 predicted 840
3 SASI_Mm01_00284008 predicted 260
4 SASI_Mm01_00284009 predicted 579
5 SASI_Mm01_00284010 predicted 523
6 SASI_Mm01_00284011 predicted 345
7 SASI_Mm01_00284012 predicted 829
8 SASI_Mm01_00284013 predicted 323
9 SASI_Mm01_00284014 predicted 537
10 SASI_Mm01_00284015 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144967
ARHGAP36 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 36
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144967.3-1587s21c1
Sequence:CCGGGGTCCGTGCCATGATTGATAACTCGAGTTATCAATCATGGCACGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144967.3-2364s21c1
Sequence:CCGGCCAGATGGGATTGCATGATTTCTCGAGAAATCATGCAATCCCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144967.3-1412s21c1
Sequence:CCGGAGAACTGCGAGGACTCAATTGCTCGAGCAATTGAGTCCTCGCAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144967.2-2192s1c1
Sequence:CCGGGCAGAGATGTTTCTGTGTCATCTCGAGATGACACAGAAACATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144967.2-1458s1c1
Sequence:CCGGCAACCGTATGACTTCCACTAACTCGAGTTAGTGGAAGTCATACGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144967.2-1189s1c1
Sequence:CCGGGATGACAATCAGAATGTGCATCTCGAGATGCACATTCTGATTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144967.2-664s1c1
Sequence:CCGGGCTGTATCACACAAGACATTTCTCGAGAAATGTCTTGTGTGATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144967.2-671s1c1
Sequence:CCGGCACACAAGACATTTGGCATTACTCGAGTAATGCCAAATGTCTTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144967
ARHGAP36 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 36
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144967.3-1587s21c1
Sequence:CCGGGGTCCGTGCCATGATTGATAACTCGAGTTATCAATCATGGCACGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144967.3-2364s21c1
Sequence:CCGGCCAGATGGGATTGCATGATTTCTCGAGAAATCATGCAATCCCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144967.3-1412s21c1
Sequence:CCGGAGAACTGCGAGGACTCAATTGCTCGAGCAATTGAGTCCTCGCAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144967.2-2192s1c1
Sequence:CCGGGCAGAGATGTTTCTGTGTCATCTCGAGATGACACAGAAACATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144967.2-1458s1c1
Sequence:CCGGCAACCGTATGACTTCCACTAACTCGAGTTAGTGGAAGTCATACGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144967.2-1189s1c1
Sequence:CCGGGATGACAATCAGAATGTGCATCTCGAGATGCACATTCTGATTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144967.2-664s1c1
Sequence:CCGGGCTGTATCACACAAGACATTTCTCGAGAAATGTCTTGTGTGATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144967.2-671s1c1
Sequence:CCGGCACACAAGACATTTGGCATTACTCGAGTAATGCCAAATGTCTTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144967
ARHGAP36 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 36
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144967.3-1587s21c1
Sequence:CCGGGGTCCGTGCCATGATTGATAACTCGAGTTATCAATCATGGCACGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144967.3-2364s21c1
Sequence:CCGGCCAGATGGGATTGCATGATTTCTCGAGAAATCATGCAATCCCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144967.3-1412s21c1
Sequence:CCGGAGAACTGCGAGGACTCAATTGCTCGAGCAATTGAGTCCTCGCAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144967.2-2192s1c1
Sequence:CCGGGCAGAGATGTTTCTGTGTCATCTCGAGATGACACAGAAACATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144967.2-1458s1c1
Sequence:CCGGCAACCGTATGACTTCCACTAACTCGAGTTAGTGGAAGTCATACGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144967.2-1189s1c1
Sequence:CCGGGATGACAATCAGAATGTGCATCTCGAGATGCACATTCTGATTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144967.2-664s1c1
Sequence:CCGGGCTGTATCACACAAGACATTTCTCGAGAAATGTCTTGTGTGATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144967.2-671s1c1
Sequence:CCGGCACACAAGACATTTGGCATTACTCGAGTAATGCCAAATGTCTTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081123
ARHGAP36 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 36
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081123.1-920s21c1
Sequence:CCGGCTTGAGCTCCGTGAGTTATTTCTCGAGAAATAACTCACGGAGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081123.1-2781s21c1
Sequence:CCGGTCTATGCAGGACGGTACAAATCTCGAGATTTGTACCGTCCTGCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081123.1-1363s21c1
Sequence:CCGGTGTCCGTGCCATGATTGATAACTCGAGTTATCAATCATGGCACGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081123.1-746s21c1
Sequence:CCGGTCCCAGCTTTCATCGCCTATTCTCGAGAATAGGCGATGAAAGCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081123.1-1495s21c1
Sequence:CCGGGATCCAGAGTGCTCGCATAAACTCGAGTTTATGCGAGCACTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081123
ARHGAP36 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 36
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081123.1-920s21c1
Sequence:CCGGCTTGAGCTCCGTGAGTTATTTCTCGAGAAATAACTCACGGAGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081123.1-2781s21c1
Sequence:CCGGTCTATGCAGGACGGTACAAATCTCGAGATTTGTACCGTCCTGCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081123.1-1363s21c1
Sequence:CCGGTGTCCGTGCCATGATTGATAACTCGAGTTATCAATCATGGCACGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081123.1-746s21c1
Sequence:CCGGTCCCAGCTTTCATCGCCTATTCTCGAGAATAGGCGATGAAAGCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081123.1-1495s21c1
Sequence:CCGGGATCCAGAGTGCTCGCATAAACTCGAGTTTATGCGAGCACTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081123
ARHGAP36 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 36
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081123.1-920s21c1
Sequence:CCGGCTTGAGCTCCGTGAGTTATTTCTCGAGAAATAACTCACGGAGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081123.1-2781s21c1
Sequence:CCGGTCTATGCAGGACGGTACAAATCTCGAGATTTGTACCGTCCTGCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081123.1-1363s21c1
Sequence:CCGGTGTCCGTGCCATGATTGATAACTCGAGTTATCAATCATGGCACGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081123.1-746s21c1
Sequence:CCGGTCCCAGCTTTCATCGCCTATTCTCGAGAATAGGCGATGAAAGCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081123.1-1495s21c1
Sequence:CCGGGATCCAGAGTGCTCGCATAAACTCGAGTTTATGCGAGCACTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks