EMAIL THIS PAGE TO A FRIEND

ARHGAP39

Rho GTPase activating protein 39

82 Gene Product Result for
Synonyms: CrGAP Vilse
UniProtKB ID: Q9C0H5, B4E1I1
Gene ID:
Mouse(223666) Rho GTPase activating protein 39
Rat(500901) Rho GTPase activating protein 39
Zebrafish(560524) Rho GTPase activating protein 39
cow(532363) Rho GTPase activating protein 39
Horse(100064564) Rho GTPase activating protein 39
domestic cat(101098196) Rho GTPase activating protein 39
dog(482103) Rho GTPase activating protein 39
chicken(419132) Rho GTPase activating protein 39
sheep(101106270) Rho GTPase activating protein 39
domestic guinea pig(100717437) Rho GTPase activating protein 39
naked mole-rat(101706172) Rho GTPase activating protein 39
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_496999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496999 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025251 Rosetta Predictions human pricing
NM_173122 Rosetta Predictions rat pricing
NM_198420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242266 predicted 853
2 SASI_Hs01_00242267 predicted 3134
3 SASI_Hs01_00242268 predicted 1176
4 SASI_Hs02_00358085 predicted 1104
5 SASI_Hs01_00242269 predicted 3186
6 SASI_Hs01_00242270 predicted 3061
7 SASI_Hs02_00358086 predicted 1083
8 SASI_Hs01_00242272 predicted 3177
9 SASI_Hs01_00242273 predicted 990
10 SASI_Hs02_00358087 predicted 1098
11 SASI_Hs01_00242264 predicted 3295
12 SASI_Hs01_00242265 predicted 3109
13 SASI_Hs01_00242271 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269280 predicted 3239
2 SASI_Rn02_00269281 predicted 2585
3 SASI_Rn02_00269282 predicted 2341
4 SASI_Rn02_00269283 predicted 2403
5 SASI_Rn02_00269284 predicted 2694
6 SASI_Rn02_00269285 predicted 702
7 SASI_Rn02_00269286 predicted 968
8 SASI_Rn02_00269287 predicted 3512
9 SASI_Rn02_00269288 predicted 2840
10 SASI_Rn02_00269289 predicted 3531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026395 predicted 3156
2 SASI_Mm01_00026396 predicted 2599
3 SASI_Mm01_00026397 predicted 709
4 SASI_Mm01_00026398 predicted 2407
5 SASI_Mm01_00026399 predicted 2424
6 SASI_Mm01_00026401 predicted 2458
7 SASI_Mm01_00026402 predicted 1974
8 SASI_Mm02_00350982 predicted 1013
9 SASI_Mm01_00026403 predicted 2760
10 SASI_Mm01_00026404 predicted 3446
11 SASI_Mm01_00026400 predicted 1297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198420
VALIDATED
ARHGAP39 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 39
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198420.1-4085s1c1
Sequence:CCGGCGACAGAACTAAGTTTGCTAACTCGAGTTAGCAAACTTAGTTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198420.1-3161s1c1
Sequence:CCGGCCTCATGAATTCTACGAACAACTCGAGTTGTTCGTAGAATTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198420.1-844s1c1
Sequence:CCGGGCGATGGAACTCTGGTAACAACTCGAGTTGTTACCAGAGTTCCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198420.1-3383s1c1
Sequence:CCGGCCTCGCGTCATCTTCGAGAATCTCGAGATTCTCGAAGATGACGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198420.1-530s1c1
Sequence:CCGGCCACAGAACTGCGACATCATTCTCGAGAATGATGTCGCAGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198420
VALIDATED
ARHGAP39 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 39
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198420.1-4085s1c1
Sequence:CCGGCGACAGAACTAAGTTTGCTAACTCGAGTTAGCAAACTTAGTTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198420.1-3161s1c1
Sequence:CCGGCCTCATGAATTCTACGAACAACTCGAGTTGTTCGTAGAATTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198420.1-844s1c1
Sequence:CCGGGCGATGGAACTCTGGTAACAACTCGAGTTGTTACCAGAGTTCCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198420.1-3383s1c1
Sequence:CCGGCCTCGCGTCATCTTCGAGAATCTCGAGATTCTCGAAGATGACGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198420.1-530s1c1
Sequence:CCGGCCACAGAACTGCGACATCATTCTCGAGAATGATGTCGCAGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198420
VALIDATED
ARHGAP39 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 39
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198420.1-4085s1c1
Sequence:CCGGCGACAGAACTAAGTTTGCTAACTCGAGTTAGCAAACTTAGTTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198420.1-3161s1c1
Sequence:CCGGCCTCATGAATTCTACGAACAACTCGAGTTGTTCGTAGAATTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198420.1-844s1c1
Sequence:CCGGGCGATGGAACTCTGGTAACAACTCGAGTTGTTACCAGAGTTCCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198420.1-3383s1c1
Sequence:CCGGCCTCGCGTCATCTTCGAGAATCTCGAGATTCTCGAAGATGACGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198420.1-530s1c1
Sequence:CCGGCCACAGAACTGCGACATCATTCTCGAGAATGATGTCGCAGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496999
VALIDATED
ARHGAP39 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 39
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-879s1c1
Sequence:CCGGCTATGAGATTTACCGGGATTACTCGAGTAATCCCGGTAAATCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-565s1c1
Sequence:CCGGTCCCGCTTCTACTACTACAATCTCGAGATTGTAGTAGTAGAAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-1815s1c1
Sequence:CCGGGAAGAGCAGAAAGCCCTCTTTCTCGAGAAAGAGGGCTTTCTGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-4384s1c1
Sequence:CCGGCCACCGTGTATAGAGATATAACTCGAGTTATATCTCTATACACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-2877s1c1
Sequence:CCGGCCTGGAAAGAAACACTAAGAACTCGAGTTCTTAGTGTTTCTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496999
VALIDATED
ARHGAP39 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 39
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-879s1c1
Sequence:CCGGCTATGAGATTTACCGGGATTACTCGAGTAATCCCGGTAAATCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-565s1c1
Sequence:CCGGTCCCGCTTCTACTACTACAATCTCGAGATTGTAGTAGTAGAAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-1815s1c1
Sequence:CCGGGAAGAGCAGAAAGCCCTCTTTCTCGAGAAAGAGGGCTTTCTGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-4384s1c1
Sequence:CCGGCCACCGTGTATAGAGATATAACTCGAGTTATATCTCTATACACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-2877s1c1
Sequence:CCGGCCTGGAAAGAAACACTAAGAACTCGAGTTCTTAGTGTTTCTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496999
VALIDATED
ARHGAP39 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 39
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-879s1c1
Sequence:CCGGCTATGAGATTTACCGGGATTACTCGAGTAATCCCGGTAAATCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-565s1c1
Sequence:CCGGTCCCGCTTCTACTACTACAATCTCGAGATTGTAGTAGTAGAAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-1815s1c1
Sequence:CCGGGAAGAGCAGAAAGCCCTCTTTCTCGAGAAAGAGGGCTTTCTGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-4384s1c1
Sequence:CCGGCCACCGTGTATAGAGATATAACTCGAGTTATATCTCTATACACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:XM_496999.1-2877s1c1
Sequence:CCGGCCTGGAAAGAAACACTAAGAACTCGAGTTCTTAGTGTTTCTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks