EMAIL THIS PAGE TO A FRIEND

ARHGAP40

Rho GTPase activating protein 40

105 Gene Product Result for
Synonyms: C20orf95 dJ1100H13.4
UniProtKB ID: Q5TG30
Gene ID:
Mouse(545481) Rho GTPase activating protein 40
Rat(296323) Rho GTPase activating protein 40
chicken(419168) Rho GTPase activating protein 40
dog(100683527) Rho GTPase activating protein 40
domestic cat(101094411) Rho GTPase activating protein 40
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001164431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001164431 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001145015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001145015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001145015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_293123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_293123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_293123 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715877 Rosetta Predictions human pricing
XM_293123 Rosetta Predictions human pricing
XM_937379 Rosetta Predictions human pricing
XM_001068716 Rosetta Predictions rat pricing
XM_230802 Rosetta Predictions rat pricing
XM_619836 Rosetta Predictions mouse pricing
XR_002778 Rosetta Predictions mouse pricing
XR_035595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00406703 predicted 669
2 SASI_Hs02_00406704 predicted 1071
3 SASI_Hs02_00406705 predicted 1713
4 SASI_Hs02_00406706 predicted 1482
5 SASI_Hs02_00406707 predicted 1935
6 SASI_Hs02_00406708 predicted 1193
7 SASI_Hs02_00406709 predicted 338
8 SASI_Hs02_00406710 predicted 1189
9 SASI_Hs02_00406711 predicted 449
10 SASI_Hs02_00406712 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_293123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479137 predicted 662
2 SASI_Hs01_00277660 predicted 1066
3 SASI_Hs02_00479138 predicted 1719
4 SASI_Hs01_00277663 predicted 1481
5 SASI_Hs02_00479139 predicted 1933
6 SASI_Hs01_00277665 predicted 345
7 SASI_Hs01_00277666 predicted 1189
8 SASI_Hs01_00277667 predicted 456
9 SASI_Hs01_00277668 predicted 1410
10 SASI_Hs01_00277669 predicted 1082
11 SASI_Hs01_00277661 predicted 1026
12 SASI_Hs01_00277662 predicted 828
13 SASI_Hs01_00277664 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482576 predicted 663
2 SASI_Hs02_00482577 predicted 1072
3 SASI_Hs02_00482578 predicted 1714
4 SASI_Hs02_00482579 predicted 1488
5 SASI_Hs02_00482580 predicted 341
6 SASI_Hs02_00482581 predicted 1188
7 SASI_Hs02_00482582 predicted 455
8 SASI_Hs02_00482583 predicted 1406
9 SASI_Hs02_00482584 predicted 1087
10 SASI_Hs02_00482585 predicted 1940
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325599 predicted 762
2 SASI_Rn02_00325600 predicted 1081
3 SASI_Rn02_00325601 predicted 1172
4 SASI_Rn02_00325602 predicted 421
5 SASI_Rn02_00325603 predicted 843
6 SASI_Rn02_00325604 predicted 1236
7 SASI_Rn02_00325605 predicted 844
8 SASI_Rn02_00325606 predicted 875
9 SASI_Rn02_00325607 predicted 1120
10 SASI_Rn02_00325608 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386482 predicted 280
2 SASI_Rn02_00386483 predicted 1100
3 SASI_Rn02_00386484 predicted 761
4 SASI_Rn02_00386485 predicted 208
5 SASI_Rn02_00386486 predicted 256
6 SASI_Rn02_00386487 predicted 967
7 SASI_Rn02_00386488 predicted 419
8 SASI_Rn02_00386489 predicted 843
9 SASI_Rn02_00386490 predicted 1030
10 SASI_Rn02_00386491 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427503 predicted 1569
2 SASI_Mm02_00427504 predicted 1555
3 SASI_Mm02_00427505 predicted 1709
4 SASI_Mm02_00427506 predicted 1579
5 SASI_Mm02_00427507 predicted 1638
6 SASI_Mm02_00427508 predicted 1735
7 SASI_Mm02_00427509 predicted 1516
8 SASI_Mm02_00427510 predicted 1528
9 SASI_Mm02_00427511 predicted 1797
10 SASI_Mm02_00427512 predicted 1659
11 SASI_Mm01_00219605 predicted 341
12 SASI_Mm01_00219606 predicted 351
13 SASI_Mm01_00219607 predicted 332
14 SASI_Mm01_00219608 predicted 261
15 SASI_Mm01_00219609 predicted 399
16 SASI_Mm01_00219610 predicted 315
17 SASI_Mm01_00219611 predicted 379
18 SASI_Mm01_00219612 predicted 423
19 SASI_Mm01_00219613 predicted 266
20 SASI_Mm01_00219614 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_002778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251767 predicted 344
2 SASI_Mm01_00251768 predicted 346
3 SASI_Mm01_00251769 predicted 336
4 SASI_Mm01_00251770 predicted 257
5 SASI_Mm01_00251771 predicted 400
6 SASI_Mm01_00251772 predicted 316
7 SASI_Mm01_00251773 predicted 377
8 SASI_Mm01_00251774 predicted 422
9 SASI_Mm01_00251775 predicted 256
10 SASI_Mm01_00251776 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00483429 predicted 1029
2 SASI_Mm02_00483430 predicted 996
3 SASI_Mm02_00483431 predicted 772
4 SASI_Mm02_00483432 predicted 1333
5 SASI_Mm02_00483433 predicted 940
6 SASI_Mm02_00483434 predicted 263
7 SASI_Mm02_00483435 predicted 1352
8 SASI_Mm02_00483436 predicted 912
9 SASI_Mm02_00483437 predicted 1110
10 SASI_Mm02_00483438 predicted 1085
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164431
ARHGAP40 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 40
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000437456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164431.1-776s21c1
Sequence:CCGGAGTGTTCCCTGCCGAAGTTTACTCGAGTAAACTTCGGCAGGGAACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164431
ARHGAP40 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 40
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000437456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164431.1-776s21c1
Sequence:CCGGAGTGTTCCCTGCCGAAGTTTACTCGAGTAAACTTCGGCAGGGAACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164431
ARHGAP40 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 40
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000437456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164431.1-776s21c1
Sequence:CCGGAGTGTTCCCTGCCGAAGTTTACTCGAGTAAACTTCGGCAGGGAACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145015
ARHGAP40 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 40
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-575s21c1
Sequence:CCGGATGGAGTCTCAGGAATGAAATCTCGAGATTTCATTCCTGAGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-399s21c1
Sequence:CCGGGGGCTTGGATGGTGATCATCACTCGAGTGATGATCACCATCCAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-333s21c1
Sequence:CCGGCCTAGAAGGAGACACCGAATCCTCGAGGATTCGGTGTCTCCTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-521s21c1
Sequence:CCGGGAGACGTCAGGGATATCTTTGCTCGAGCAAAGATATCCCTGACGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-1136s21c1
Sequence:CCGGAGCTGGAGCGAGACTTCTATGCTCGAGCATAGAAGTCTCGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145015
ARHGAP40 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 40
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-575s21c1
Sequence:CCGGATGGAGTCTCAGGAATGAAATCTCGAGATTTCATTCCTGAGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-399s21c1
Sequence:CCGGGGGCTTGGATGGTGATCATCACTCGAGTGATGATCACCATCCAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-333s21c1
Sequence:CCGGCCTAGAAGGAGACACCGAATCCTCGAGGATTCGGTGTCTCCTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-521s21c1
Sequence:CCGGGAGACGTCAGGGATATCTTTGCTCGAGCAAAGATATCCCTGACGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-1136s21c1
Sequence:CCGGAGCTGGAGCGAGACTTCTATGCTCGAGCATAGAAGTCTCGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145015
ARHGAP40 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 40
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-575s21c1
Sequence:CCGGATGGAGTCTCAGGAATGAAATCTCGAGATTTCATTCCTGAGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-399s21c1
Sequence:CCGGGGGCTTGGATGGTGATCATCACTCGAGTGATGATCACCATCCAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-333s21c1
Sequence:CCGGCCTAGAAGGAGACACCGAATCCTCGAGGATTCGGTGTCTCCTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-521s21c1
Sequence:CCGGGAGACGTCAGGGATATCTTTGCTCGAGCAAAGATATCCCTGACGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145015.1-1136s21c1
Sequence:CCGGAGCTGGAGCGAGACTTCTATGCTCGAGCATAGAAGTCTCGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_293123
ARHGAP40 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 40
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-899s1c1
Sequence:CCGGGAGACTTCTATGCTGGCCTTTCTCGAGAAAGGCCAGCATAGAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-700s1c1
Sequence:CCGGGCGGCAGAAACTCGCCTCTTTCTCGAGAAAGAGGCGAGTTTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-241s1c1
Sequence:CCGGGCTCGCTCAGTGCGAAGACAACTCGAGTTGTCTTCGCACTGAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-1864s1c1
Sequence:CCGGGTGGCCCTACAATGTGTAGTACTCGAGTACTACACATTGTAGGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-1804s1c1
Sequence:CCGGCCAGATGCCTACCTCTTAGATCTCGAGATCTAAGAGGTAGGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_293123
ARHGAP40 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 40
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-899s1c1
Sequence:CCGGGAGACTTCTATGCTGGCCTTTCTCGAGAAAGGCCAGCATAGAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-700s1c1
Sequence:CCGGGCGGCAGAAACTCGCCTCTTTCTCGAGAAAGAGGCGAGTTTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-241s1c1
Sequence:CCGGGCTCGCTCAGTGCGAAGACAACTCGAGTTGTCTTCGCACTGAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-1864s1c1
Sequence:CCGGGTGGCCCTACAATGTGTAGTACTCGAGTACTACACATTGTAGGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-1804s1c1
Sequence:CCGGCCAGATGCCTACCTCTTAGATCTCGAGATCTAAGAGGTAGGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_293123
ARHGAP40 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 40
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-899s1c1
Sequence:CCGGGAGACTTCTATGCTGGCCTTTCTCGAGAAAGGCCAGCATAGAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-700s1c1
Sequence:CCGGGCGGCAGAAACTCGCCTCTTTCTCGAGAAAGAGGCGAGTTTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-241s1c1
Sequence:CCGGGCTCGCTCAGTGCGAAGACAACTCGAGTTGTCTTCGCACTGAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-1864s1c1
Sequence:CCGGGTGGCCCTACAATGTGTAGTACTCGAGTACTACACATTGTAGGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293123.3-1804s1c1
Sequence:CCGGCCAGATGCCTACCTCTTAGATCTCGAGATCTAAGAGGTAGGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks