EMAIL THIS PAGE TO A FRIEND

ARHGAP42

Rho GTPase activating protein 42

173 Gene Product Result for
Synonyms: GRAF3
UniProtKB ID: A6NI28, Q96M56
Gene ID:
Mouse(71544) Rho GTPase activating protein 42
Rat(500943) Rho GTPase activating protein 42
naked mole-rat(101723602) Rho GTPase activating protein 42
domestic guinea pig(100730555) Rho GTPase activating protein 42
sheep(101121370) Rho GTPase activating protein 42
Domestic Rabbit(100348963) Rho GTPase activating protein 42
Zebrafish(569534) Rho GTPase activating protein 42
chicken(418990) Rho GTPase activating protein 42
cow(508009) Rho GTPase activating protein 42
dog(476762) Rho GTPase activating protein 42
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU173641 MISSION® esiRNA esiRNA targeting mouse Arhgap42 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001127597 Rosetta Predictions human pricing
XM_001725431 Rosetta Predictions human pricing
XM_001726122 Rosetta Predictions human pricing
XM_370651 Rosetta Predictions human pricing
XM_925815 Rosetta Predictions human pricing
XM_001073215 Rosetta Predictions rat pricing
XM_576354 Rosetta Predictions rat pricing
XM_146632 Rosetta Predictions mouse pricing
XM_984736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001127597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00383983 predicted 1355
2 SASI_Hs02_00383984 predicted 818
3 SASI_Hs02_00383985 predicted 324
4 SASI_Hs02_00383986 predicted 1595
5 SASI_Hs02_00383987 predicted 511
6 SASI_Hs02_00383988 predicted 1962
7 SASI_Hs02_00383989 predicted 2037
8 SASI_Hs02_00383990 predicted 1399
9 SASI_Hs02_00383991 predicted 201
10 SASI_Hs02_00383992 predicted 1788
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00467683 predicted 1346
2 SASI_Hs02_00467684 predicted 817
3 SASI_Hs02_00467685 predicted 318
4 SASI_Hs02_00467686 predicted 1599
5 SASI_Hs02_00467687 predicted 515
6 SASI_Hs02_00467688 predicted 1965
7 SASI_Hs02_00467689 predicted 2036
8 SASI_Hs02_00467690 predicted 1401
9 SASI_Hs02_00467691 predicted 200
10 SASI_Hs02_00467692 predicted 1785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00472088 predicted 717
2 SASI_Hs02_00472089 predicted 1152
3 SASI_Hs02_00472090 predicted 325
4 SASI_Hs02_00472091 predicted 1394
5 SASI_Hs02_00472092 predicted 407
6 SASI_Hs02_00472093 predicted 1761
7 SASI_Hs02_00472094 predicted 1832
8 SASI_Hs02_00472095 predicted 1200
9 SASI_Hs02_00472096 predicted 199
10 SASI_Hs02_00472097 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272214 predicted 1331
2 SASI_Hs01_00272215 predicted 226
3 SASI_Hs01_00272216 predicted 1319
4 SASI_Hs01_00272217 predicted 474
5 SASI_Hs01_00272218 predicted 450
6 SASI_Hs01_00272219 predicted 470
7 SASI_Hs01_00272220 predicted 835
8 SASI_Hs01_00272221 predicted 907
9 SASI_Hs01_00272222 predicted 1304
10 SASI_Hs01_00272223 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280950 predicted 1513
2 SASI_Hs01_00280951 predicted 213
3 SASI_Hs01_00280952 predicted 1331
4 SASI_Hs01_00280953 predicted 469
5 SASI_Hs01_00280954 predicted 446
6 SASI_Hs01_00280955 predicted 462
7 SASI_Hs01_00280956 predicted 831
8 SASI_Hs01_00280957 predicted 903
9 SASI_Hs01_00280958 predicted 1484
10 SASI_Hs01_00280959 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341926 predicted 539
2 SASI_Rn02_00341927 predicted 1591
3 SASI_Rn02_00341928 predicted 1224
4 SASI_Rn02_00341929 predicted 669
5 SASI_Rn02_00341930 predicted 1153
6 SASI_Rn02_00341931 predicted 704
7 SASI_Rn02_00341932 predicted 600
8 SASI_Rn02_00341933 predicted 1317
9 SASI_Rn02_00341934 predicted 1216
10 SASI_Rn02_00341935 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405121 predicted 734
2 SASI_Rn02_00405122 predicted 456
3 SASI_Rn02_00405123 predicted 536
4 SASI_Rn02_00405124 predicted 912
5 SASI_Rn02_00405125 predicted 675
6 SASI_Rn02_00405126 predicted 443
7 SASI_Rn02_00405127 predicted 700
8 SASI_Rn02_00405128 predicted 1052
9 SASI_Rn02_00405129 predicted 280
10 SASI_Rn02_00405130 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425307 predicted 2707
2 SASI_Mm01_00202906 predicted 2958
3 SASI_Mm02_00425308 predicted 2748
4 SASI_Mm02_00425309 predicted 2565
5 SASI_Mm02_00425310 predicted 2954
6 SASI_Mm01_00202910 predicted 1705
7 SASI_Mm02_00425311 predicted 2528
8 SASI_Mm01_00202914 predicted 2651
9 SASI_Mm02_00425312 predicted 2919
10 SASI_Mm02_00425313 predicted 333
11 SASI_Mm01_00202905 predicted 755
12 SASI_Mm01_00202907 predicted 980
13 SASI_Mm01_00202908 predicted 1510
14 SASI_Mm01_00202909 predicted 903
15 SASI_Mm01_00202911 predicted 1627
16 SASI_Mm01_00202912 predicted 889
17 SASI_Mm01_00202913 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448565 predicted 838
2 SASI_Mm02_00448566 predicted 974
3 SASI_Mm02_00448567 predicted 1502
4 SASI_Mm02_00448568 predicted 897
5 SASI_Mm02_00448569 predicted 1702
6 SASI_Mm02_00448570 predicted 1614
7 SASI_Mm02_00448571 predicted 881
8 SASI_Mm02_00448572 predicted 988
9 SASI_Mm02_00448573 predicted 1634
10 SASI_Mm02_00448574 predicted 2648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152432
VALIDATED
ARHGAP42 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 42
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_152432.2-945s21c1
Sequence:CCGGTGTTACTAGCTCACCGGAAATCTCGAGATTTCCGGTGAGCTAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_152432.2-2550s21c1
Sequence:CCGGAGTGGAACCAGGATGGTTAAACTCGAGTTTAACCATCCTGGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152432.2-657s21c1
Sequence:CCGGCCAGGAATTTGCACCGTATAACTCGAGTTATACGGTGCAAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152432.2-2658s21c1
Sequence:CCGGGGTATCCATGGTAACGAATAACTCGAGTTATTCGTTACCATGGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_152432.2-1111s21c1
Sequence:CCGGGATGGGAAGGAACCGATTTATCTCGAGATAAATCGGTTCCTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152432
VALIDATED
ARHGAP42 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 42
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_152432.2-945s21c1
Sequence:CCGGTGTTACTAGCTCACCGGAAATCTCGAGATTTCCGGTGAGCTAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_152432.2-2550s21c1
Sequence:CCGGAGTGGAACCAGGATGGTTAAACTCGAGTTTAACCATCCTGGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152432.2-657s21c1
Sequence:CCGGCCAGGAATTTGCACCGTATAACTCGAGTTATACGGTGCAAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152432.2-2658s21c1
Sequence:CCGGGGTATCCATGGTAACGAATAACTCGAGTTATTCGTTACCATGGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_152432.2-1111s21c1
Sequence:CCGGGATGGGAAGGAACCGATTTATCTCGAGATAAATCGGTTCCTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152432
VALIDATED
ARHGAP42 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 42
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_152432.2-945s21c1
Sequence:CCGGTGTTACTAGCTCACCGGAAATCTCGAGATTTCCGGTGAGCTAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_152432.2-2550s21c1
Sequence:CCGGAGTGGAACCAGGATGGTTAAACTCGAGTTTAACCATCCTGGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152432.2-657s21c1
Sequence:CCGGCCAGGAATTTGCACCGTATAACTCGAGTTATACGGTGCAAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152432.2-2658s21c1
Sequence:CCGGGGTATCCATGGTAACGAATAACTCGAGTTATTCGTTACCATGGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_152432.2-1111s21c1
Sequence:CCGGGATGGGAAGGAACCGATTTATCTCGAGATAAATCGGTTCCTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027823
ARHGAP42 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 42
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027823.1-1169s21c1
Sequence:CCGGTCGAAAGGCATGGCATCATTACTCGAGTAATGATGCCATGCCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027823.1-930s21c1
Sequence:CCGGGACCATGGAGGGCTATCTTTACTCGAGTAAAGATAGCCCTCCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027823.1-1258s21c1
Sequence:CCGGTACACGTTACCCGCCATAATTCTCGAGAATTATGGCGGGTAACGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027823.1-5215s21c1
Sequence:CCGGGCACTTGTGCTTGCGATTTAACTCGAGTTAAATCGCAAGCACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027823.1-1473s21c1
Sequence:CCGGGTGGGACAATAAGACTATAACCTCGAGGTTATAGTCTTATTGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027823
ARHGAP42 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 42
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027823.1-1169s21c1
Sequence:CCGGTCGAAAGGCATGGCATCATTACTCGAGTAATGATGCCATGCCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027823.1-930s21c1
Sequence:CCGGGACCATGGAGGGCTATCTTTACTCGAGTAAAGATAGCCCTCCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027823.1-1258s21c1
Sequence:CCGGTACACGTTACCCGCCATAATTCTCGAGAATTATGGCGGGTAACGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027823.1-5215s21c1
Sequence:CCGGGCACTTGTGCTTGCGATTTAACTCGAGTTAAATCGCAAGCACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027823.1-1473s21c1
Sequence:CCGGGTGGGACAATAAGACTATAACCTCGAGGTTATAGTCTTATTGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027823
ARHGAP42 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 42
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027823.1-1169s21c1
Sequence:CCGGTCGAAAGGCATGGCATCATTACTCGAGTAATGATGCCATGCCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027823.1-930s21c1
Sequence:CCGGGACCATGGAGGGCTATCTTTACTCGAGTAAAGATAGCCCTCCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027823.1-1258s21c1
Sequence:CCGGTACACGTTACCCGCCATAATTCTCGAGAATTATGGCGGGTAACGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027823.1-5215s21c1
Sequence:CCGGGCACTTGTGCTTGCGATTTAACTCGAGTTAAATCGCAAGCACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027823.1-1473s21c1
Sequence:CCGGGTGGGACAATAAGACTATAACCTCGAGGTTATAGTCTTATTGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks