EMAIL THIS PAGE TO A FRIEND

ARHGAP44

Rho GTPase activating protein 44

96 Gene Product Result for
Synonyms: NPC-A-10 RICH2
UniProtKB ID: Q17R89, A8MQB2, O75160, Q7Z5Z7
Gene ID:
Mouse(216831) Rho GTPase activating protein 44
Rat(303222) Rho GTPase activating protein 44
Zebrafish(100333556) Rho GTPase activating protein 44
dog(489510) Rho GTPase activating protein 44
domestic cat(101086932) Rho GTPase activating protein 44
cow(509257) Rho GTPase activating protein 44
Horse(100073101) Rho GTPase activating protein 44
chicken(427797) Rho GTPase activating protein 44
sheep(101104674) Rho GTPase activating protein 44
domestic guinea pig(100733107) Rho GTPase activating protein 44
naked mole-rat(101721366) Rho GTPase activating protein 44
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014859 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175003 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175003 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175003 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014859 Rosetta Predictions human pricing
XM_220588 Rosetta Predictions rat pricing
NM_001099288 Rosetta Predictions mouse pricing
NM_175003 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241578 predicted 1029
2 SASI_Hs01_00241579 predicted 1516
3 SASI_Hs01_00241580 predicted 1585
4 SASI_Hs02_00346439 predicted 1373
5 SASI_Hs01_00241582 predicted 1450
6 SASI_Hs01_00241583 predicted 460
7 SASI_Hs02_00346440 predicted 1576
8 SASI_Hs01_00241584 predicted 2657
9 SASI_Hs01_00241585 predicted 954
10 SASI_Hs01_00241586 predicted 802
11 SASI_Hs01_00241581 predicted 1489
12 SASI_Hs01_00241587 predicted 2617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126450 predicted 1490
2 SASI_Rn01_00126451 predicted 1199
3 SASI_Rn01_00126452 predicted 1697
4 SASI_Rn01_00126453 predicted 609
5 SASI_Rn01_00126454 predicted 980
6 SASI_Rn01_00126455 predicted 328
7 SASI_Rn01_00126456 predicted 1481
8 SASI_Rn01_00126457 predicted 245
9 SASI_Rn01_00126458 predicted 2416
10 SASI_Rn01_00126459 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301541 predicted 1338
2 SASI_Mm02_00301542 predicted 1329
3 SASI_Mm02_00301543 predicted 1119
4 SASI_Mm02_00301544 predicted 1349
5 SASI_Mm02_00301545 predicted 459
6 SASI_Mm02_00301546 predicted 380
7 SASI_Mm02_00301547 predicted 1865
8 SASI_Mm02_00301548 predicted 957
9 SASI_Mm02_00301549 predicted 1021
10 SASI_Mm02_00301550 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175003 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345559 predicted 1334
2 SASI_Mm02_00345560 predicted 1326
3 SASI_Mm01_00197665 predicted 1119
4 SASI_Mm01_00197666 predicted 1357
5 SASI_Mm01_00197667 predicted 452
6 SASI_Mm01_00197668 predicted 381
7 SASI_Mm01_00197669 predicted 1866
8 SASI_Mm01_00197670 predicted 954
9 SASI_Mm01_00197671 predicted 1019
10 SASI_Mm01_00197672 predicted 1656
11 SASI_Mm01_00197664 predicted 1338
12 SASI_Mm01_00197673 predicted 1549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014859
VALIDATED
ARHGAP44 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 44
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014859.4-3194s21c1
Sequence:CCGGAGGTCTTGCAGGATCAGTTTACTCGAGTAAACTGATCCTGCAAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014859.4-1713s21c1
Sequence:CCGGCGTGAACCATAATGCCAACTACTCGAGTAGTTGGCATTATGGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014859.4-1802s21c1
Sequence:CCGGTCAGCGTCGCCACGGATAATACTCGAGTATTATCCGTGGCGACGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014859.4-941s21c1
Sequence:CCGGTGGCCAAAGAAATTGACTATGCTCGAGCATAGTCAATTTCTTTGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014859.4-965s21c1
Sequence:CCGGACTACTTTCAAACGCTAATAGCTCGAGCTATTAGCGTTTGAAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014859.3-1581s1c1
Sequence:CCGGGCTGCAAATTGTTGGGATCATCTCGAGATGATCCCAACAATTTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014859.3-2625s1c1
Sequence:CCGGCCACTTTGATATTCCCTCGATCTCGAGATCGAGGGAATATCAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014859.3-1686s1c1
Sequence:CCGGCGTGAACCATAATGCCAACTACTCGAGTAGTTGGCATTATGGTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014859.3-1495s1c1
Sequence:CCGGCCCAGTAATATGGCAATTGTTCTCGAGAACAATTGCCATATTACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014859.3-1461s1c1
Sequence:CCGGGCTGTCAGAATATCAAGATGTCTCGAGACATCTTGATATTCTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014859.3-963s1c1
Sequence:CCGGGCAAGCTGAATACCACAGGAACTCGAGTTCCTGTGGTATTCAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183518    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014859.3-3845s1c1
Sequence:CCGGGCATGCAAAGTCAAAGTTTAACTCGAGTTAAACTTTGACTTTGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014859
VALIDATED
ARHGAP44 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 44
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014859.4-3194s21c1
Sequence:CCGGAGGTCTTGCAGGATCAGTTTACTCGAGTAAACTGATCCTGCAAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014859.4-1713s21c1
Sequence:CCGGCGTGAACCATAATGCCAACTACTCGAGTAGTTGGCATTATGGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014859.4-1802s21c1
Sequence:CCGGTCAGCGTCGCCACGGATAATACTCGAGTATTATCCGTGGCGACGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014859.4-941s21c1
Sequence:CCGGTGGCCAAAGAAATTGACTATGCTCGAGCATAGTCAATTTCTTTGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014859.4-965s21c1
Sequence:CCGGACTACTTTCAAACGCTAATAGCTCGAGCTATTAGCGTTTGAAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014859.3-1581s1c1
Sequence:CCGGGCTGCAAATTGTTGGGATCATCTCGAGATGATCCCAACAATTTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014859.3-2625s1c1
Sequence:CCGGCCACTTTGATATTCCCTCGATCTCGAGATCGAGGGAATATCAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014859.3-1686s1c1
Sequence:CCGGCGTGAACCATAATGCCAACTACTCGAGTAGTTGGCATTATGGTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014859.3-1495s1c1
Sequence:CCGGCCCAGTAATATGGCAATTGTTCTCGAGAACAATTGCCATATTACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014859.3-1461s1c1
Sequence:CCGGGCTGTCAGAATATCAAGATGTCTCGAGACATCTTGATATTCTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014859.3-963s1c1
Sequence:CCGGGCAAGCTGAATACCACAGGAACTCGAGTTCCTGTGGTATTCAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183518    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014859.3-3845s1c1
Sequence:CCGGGCATGCAAAGTCAAAGTTTAACTCGAGTTAAACTTTGACTTTGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014859
VALIDATED
ARHGAP44 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 44
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014859.4-3194s21c1
Sequence:CCGGAGGTCTTGCAGGATCAGTTTACTCGAGTAAACTGATCCTGCAAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014859.4-1713s21c1
Sequence:CCGGCGTGAACCATAATGCCAACTACTCGAGTAGTTGGCATTATGGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014859.4-1802s21c1
Sequence:CCGGTCAGCGTCGCCACGGATAATACTCGAGTATTATCCGTGGCGACGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014859.4-941s21c1
Sequence:CCGGTGGCCAAAGAAATTGACTATGCTCGAGCATAGTCAATTTCTTTGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014859.4-965s21c1
Sequence:CCGGACTACTTTCAAACGCTAATAGCTCGAGCTATTAGCGTTTGAAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014859.3-1581s1c1
Sequence:CCGGGCTGCAAATTGTTGGGATCATCTCGAGATGATCCCAACAATTTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014859.3-2625s1c1
Sequence:CCGGCCACTTTGATATTCCCTCGATCTCGAGATCGAGGGAATATCAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014859.3-1686s1c1
Sequence:CCGGCGTGAACCATAATGCCAACTACTCGAGTAGTTGGCATTATGGTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014859.3-1495s1c1
Sequence:CCGGCCCAGTAATATGGCAATTGTTCTCGAGAACAATTGCCATATTACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014859.3-1461s1c1
Sequence:CCGGGCTGTCAGAATATCAAGATGTCTCGAGACATCTTGATATTCTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014859.3-963s1c1
Sequence:CCGGGCAAGCTGAATACCACAGGAACTCGAGTTCCTGTGGTATTCAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183518    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014859.3-3845s1c1
Sequence:CCGGGCATGCAAAGTCAAAGTTTAACTCGAGTTAAACTTTGACTTTGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175003
ARHGAP44 MISSION shRNA Bacterial Glycerol Stock
Rho GTPase activating protein 44
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175003.2-1329s1c1
Sequence:CCGGGAGCCTCTTATGACCTTTGAACTCGAGTTCAAAGGTCATAAGAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175003.2-3537s1c1
Sequence:CCGGGCAATAATTCTGTTTCCCAAACTCGAGTTTGGGAAACAGAATTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175003.2-1371s1c1
Sequence:CCGGGCTTCTAATATCCAGGAGCAACTCGAGTTGCTCCTGGATATTAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175003.2-3437s1c1
Sequence:CCGGCCAAACACATTAGGGATCTTACTCGAGTAAGATCCCTAATGTGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175003.2-3677s1c1
Sequence:CCGGGCCTGTTCATACTTTGGGATTCTCGAGAATCCCAAAGTATGAACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175003
ARHGAP44 MISSION shRNA shRNA Plasmid DNA
Rho GTPase activating protein 44
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175003.2-1329s1c1
Sequence:CCGGGAGCCTCTTATGACCTTTGAACTCGAGTTCAAAGGTCATAAGAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175003.2-3537s1c1
Sequence:CCGGGCAATAATTCTGTTTCCCAAACTCGAGTTTGGGAAACAGAATTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175003.2-1371s1c1
Sequence:CCGGGCTTCTAATATCCAGGAGCAACTCGAGTTGCTCCTGGATATTAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175003.2-3437s1c1
Sequence:CCGGCCAAACACATTAGGGATCTTACTCGAGTAAGATCCCTAATGTGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175003.2-3677s1c1
Sequence:CCGGGCCTGTTCATACTTTGGGATTCTCGAGAATCCCAAAGTATGAACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175003
ARHGAP44 MISSION shRNA Lentiviral Transduction Particles
Rho GTPase activating protein 44
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175003.2-1329s1c1
Sequence:CCGGGAGCCTCTTATGACCTTTGAACTCGAGTTCAAAGGTCATAAGAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175003.2-3537s1c1
Sequence:CCGGGCAATAATTCTGTTTCCCAAACTCGAGTTTGGGAAACAGAATTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175003.2-1371s1c1
Sequence:CCGGGCTTCTAATATCCAGGAGCAACTCGAGTTGCTCCTGGATATTAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175003.2-3437s1c1
Sequence:CCGGCCAAACACATTAGGGATCTTACTCGAGTAAGATCCCTAATGTGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175003.2-3677s1c1
Sequence:CCGGGCCTGTTCATACTTTGGGATTCTCGAGAATCCCAAAGTATGAACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)